ID: 1203262782

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:177820-177842
Sequence GGCGCCCATCTCCGCCACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203262782_1203262789 25 Left 1203262782 22_KI270733v1_random:177820-177842 CCGGAGTGGCGGAGATGGGCGCC No data
Right 1203262789 22_KI270733v1_random:177868-177890 ACCGATCCCGGAGAAGCCGGCGG No data
1203262782_1203262788 22 Left 1203262782 22_KI270733v1_random:177820-177842 CCGGAGTGGCGGAGATGGGCGCC No data
Right 1203262788 22_KI270733v1_random:177865-177887 GCGACCGATCCCGGAGAAGCCGG No data
1203262782_1203262787 13 Left 1203262782 22_KI270733v1_random:177820-177842 CCGGAGTGGCGGAGATGGGCGCC No data
Right 1203262787 22_KI270733v1_random:177856-177878 TGCGGTAACGCGACCGATCCCGG No data
1203262782_1203262791 26 Left 1203262782 22_KI270733v1_random:177820-177842 CCGGAGTGGCGGAGATGGGCGCC No data
Right 1203262791 22_KI270733v1_random:177869-177891 CCGATCCCGGAGAAGCCGGCGGG No data
1203262782_1203262784 -5 Left 1203262782 22_KI270733v1_random:177820-177842 CCGGAGTGGCGGAGATGGGCGCC No data
Right 1203262784 22_KI270733v1_random:177838-177860 GCGCCGCGAGGCGTCCAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203262782 Original CRISPR GGCGCCCATCTCCGCCACTC CGG (reversed) Intergenic
No off target data available for this crispr