ID: 1203262785

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:177841-177863
Sequence TTACCGCACTGGACGCCTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203262785_1203262791 5 Left 1203262785 22_KI270733v1_random:177841-177863 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1203262791 22_KI270733v1_random:177869-177891 CCGATCCCGGAGAAGCCGGCGGG No data
1203262785_1203262787 -8 Left 1203262785 22_KI270733v1_random:177841-177863 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1203262787 22_KI270733v1_random:177856-177878 TGCGGTAACGCGACCGATCCCGG No data
1203262785_1203262795 14 Left 1203262785 22_KI270733v1_random:177841-177863 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1203262795 22_KI270733v1_random:177878-177900 GAGAAGCCGGCGGGAGCCCCGGG No data
1203262785_1203262796 15 Left 1203262785 22_KI270733v1_random:177841-177863 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1203262796 22_KI270733v1_random:177879-177901 AGAAGCCGGCGGGAGCCCCGGGG No data
1203262785_1203262789 4 Left 1203262785 22_KI270733v1_random:177841-177863 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1203262789 22_KI270733v1_random:177868-177890 ACCGATCCCGGAGAAGCCGGCGG No data
1203262785_1203262788 1 Left 1203262785 22_KI270733v1_random:177841-177863 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1203262788 22_KI270733v1_random:177865-177887 GCGACCGATCCCGGAGAAGCCGG No data
1203262785_1203262794 13 Left 1203262785 22_KI270733v1_random:177841-177863 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1203262794 22_KI270733v1_random:177877-177899 GGAGAAGCCGGCGGGAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203262785 Original CRISPR TTACCGCACTGGACGCCTCG CGG (reversed) Intergenic
No off target data available for this crispr