ID: 1203262786

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:177852-177874
Sequence GATCGGTCGCGTTACCGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203262786_1203262795 3 Left 1203262786 22_KI270733v1_random:177852-177874 CCAGTGCGGTAACGCGACCGATC No data
Right 1203262795 22_KI270733v1_random:177878-177900 GAGAAGCCGGCGGGAGCCCCGGG No data
1203262786_1203262796 4 Left 1203262786 22_KI270733v1_random:177852-177874 CCAGTGCGGTAACGCGACCGATC No data
Right 1203262796 22_KI270733v1_random:177879-177901 AGAAGCCGGCGGGAGCCCCGGGG No data
1203262786_1203262794 2 Left 1203262786 22_KI270733v1_random:177852-177874 CCAGTGCGGTAACGCGACCGATC No data
Right 1203262794 22_KI270733v1_random:177877-177899 GGAGAAGCCGGCGGGAGCCCCGG No data
1203262786_1203262789 -7 Left 1203262786 22_KI270733v1_random:177852-177874 CCAGTGCGGTAACGCGACCGATC No data
Right 1203262789 22_KI270733v1_random:177868-177890 ACCGATCCCGGAGAAGCCGGCGG No data
1203262786_1203262788 -10 Left 1203262786 22_KI270733v1_random:177852-177874 CCAGTGCGGTAACGCGACCGATC No data
Right 1203262788 22_KI270733v1_random:177865-177887 GCGACCGATCCCGGAGAAGCCGG No data
1203262786_1203262801 28 Left 1203262786 22_KI270733v1_random:177852-177874 CCAGTGCGGTAACGCGACCGATC No data
Right 1203262801 22_KI270733v1_random:177903-177925 GAGTTCTCTTTTCTTTGTGAAGG No data
1203262786_1203262802 29 Left 1203262786 22_KI270733v1_random:177852-177874 CCAGTGCGGTAACGCGACCGATC No data
Right 1203262802 22_KI270733v1_random:177904-177926 AGTTCTCTTTTCTTTGTGAAGGG No data
1203262786_1203262791 -6 Left 1203262786 22_KI270733v1_random:177852-177874 CCAGTGCGGTAACGCGACCGATC No data
Right 1203262791 22_KI270733v1_random:177869-177891 CCGATCCCGGAGAAGCCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203262786 Original CRISPR GATCGGTCGCGTTACCGCAC TGG (reversed) Intergenic
No off target data available for this crispr