ID: 1203262791

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:177869-177891
Sequence CCGATCCCGGAGAAGCCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203262785_1203262791 5 Left 1203262785 22_KI270733v1_random:177841-177863 CCGCGAGGCGTCCAGTGCGGTAA No data
Right 1203262791 22_KI270733v1_random:177869-177891 CCGATCCCGGAGAAGCCGGCGGG No data
1203262782_1203262791 26 Left 1203262782 22_KI270733v1_random:177820-177842 CCGGAGTGGCGGAGATGGGCGCC No data
Right 1203262791 22_KI270733v1_random:177869-177891 CCGATCCCGGAGAAGCCGGCGGG No data
1203262786_1203262791 -6 Left 1203262786 22_KI270733v1_random:177852-177874 CCAGTGCGGTAACGCGACCGATC No data
Right 1203262791 22_KI270733v1_random:177869-177891 CCGATCCCGGAGAAGCCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203262791 Original CRISPR CCGATCCCGGAGAAGCCGGC GGG Intergenic
No off target data available for this crispr