ID: 1203263056

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:178641-178663
Sequence GCGCGCGCGTCCGCTGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203263047_1203263056 -5 Left 1203263047 22_KI270733v1_random:178623-178645 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data
1203263049_1203263056 -9 Left 1203263049 22_KI270733v1_random:178627-178649 CCCCACGTCTCGTCGCGCGCGCG No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data
1203263037_1203263056 14 Left 1203263037 22_KI270733v1_random:178604-178626 CCGGCGCGCCCCCCCCACCCCCA No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data
1203263040_1203263056 4 Left 1203263040 22_KI270733v1_random:178614-178636 CCCCCCACCCCCACCCCACGTCT No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data
1203263042_1203263056 2 Left 1203263042 22_KI270733v1_random:178616-178638 CCCCACCCCCACCCCACGTCTCG No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data
1203263035_1203263056 25 Left 1203263035 22_KI270733v1_random:178593-178615 CCCGGCGGGCGCCGGCGCGCCCC No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data
1203263045_1203263056 -3 Left 1203263045 22_KI270733v1_random:178621-178643 CCCCCACCCCACGTCTCGTCGCG No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data
1203263044_1203263056 0 Left 1203263044 22_KI270733v1_random:178618-178640 CCACCCCCACCCCACGTCTCGTC No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data
1203263043_1203263056 1 Left 1203263043 22_KI270733v1_random:178617-178639 CCCACCCCCACCCCACGTCTCGT No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data
1203263046_1203263056 -4 Left 1203263046 22_KI270733v1_random:178622-178644 CCCCACCCCACGTCTCGTCGCGC No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data
1203263036_1203263056 24 Left 1203263036 22_KI270733v1_random:178594-178616 CCGGCGGGCGCCGGCGCGCCCCC No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data
1203263041_1203263056 3 Left 1203263041 22_KI270733v1_random:178615-178637 CCCCCACCCCCACCCCACGTCTC No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data
1203263038_1203263056 6 Left 1203263038 22_KI270733v1_random:178612-178634 CCCCCCCCACCCCCACCCCACGT No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data
1203263048_1203263056 -6 Left 1203263048 22_KI270733v1_random:178624-178646 CCACCCCACGTCTCGTCGCGCGC No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data
1203263039_1203263056 5 Left 1203263039 22_KI270733v1_random:178613-178635 CCCCCCCACCCCCACCCCACGTC No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data
1203263050_1203263056 -10 Left 1203263050 22_KI270733v1_random:178628-178650 CCCACGTCTCGTCGCGCGCGCGT No data
Right 1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203263056 Original CRISPR GCGCGCGCGTCCGCTGGGGG CGG Intergenic
No off target data available for this crispr