ID: 1203266549

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:18261-18283
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 7, 1: 0, 2: 0, 3: 62, 4: 352}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203266541_1203266549 13 Left 1203266541 22_KI270734v1_random:18225-18247 CCCTTGGGAAGTCTCATGGCTAC No data
Right 1203266549 22_KI270734v1_random:18261-18283 AGGTGTGACAACAGGGAAGAGGG 0: 7
1: 0
2: 0
3: 62
4: 352
1203266542_1203266549 12 Left 1203266542 22_KI270734v1_random:18226-18248 CCTTGGGAAGTCTCATGGCTACG No data
Right 1203266549 22_KI270734v1_random:18261-18283 AGGTGTGACAACAGGGAAGAGGG 0: 7
1: 0
2: 0
3: 62
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203266549 Original CRISPR AGGTGTGACAACAGGGAAGA GGG Intergenic
903548725 1:24143009-24143031 AGGTCTGACCACAGGGTAGATGG + Intronic
903791498 1:25896313-25896335 AGCTGTGAGAGCAGGGAAGAGGG + Intronic
906376164 1:45298609-45298631 AACTGTGACTAAAGGGAAGAGGG - Intronic
907795273 1:57709838-57709860 GGTGGTGACAAAAGGGAAGATGG + Intronic
908048127 1:60194856-60194878 AAATCTGACAGCAGGGAAGAGGG + Intergenic
909474027 1:76062244-76062266 AGGTGGGACAACTCGAAAGATGG + Intergenic
909831471 1:80196676-80196698 AGGTGTGGGAAAAGGGAAGGTGG + Intergenic
910206983 1:84758096-84758118 AGGGGTTCCACCAGGGAAGATGG + Intergenic
910208176 1:84768140-84768162 AGGCGTGACACTAGGTAAGAAGG - Intergenic
912069589 1:105792922-105792944 AGGAGTGAGAAAAGAGAAGAGGG - Intergenic
912872412 1:113321196-113321218 AGGTGTGAGAACAGAGAAAAGGG - Intergenic
913392216 1:118326836-118326858 AGGTGGGACAAGGGGGAACAGGG - Intergenic
915004567 1:152623948-152623970 AGGAATGACAAAAGGGAAGCAGG + Intergenic
915642646 1:157240981-157241003 AGCTGTGAACACAGGGAAGCTGG + Intergenic
915806497 1:158858984-158859006 ACGTGTGCCAAATGGGAAGAGGG - Intergenic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
917411824 1:174767065-174767087 AGGTGAAACAACGGGGAAGTGGG - Intronic
919814922 1:201431250-201431272 GGGCGTGAGAGCAGGGAAGAAGG - Intergenic
920601872 1:207333924-207333946 AAGTGAGACAAAAAGGAAGAGGG + Intronic
920891912 1:209995246-209995268 AGGTGTCACAAGAGGTGAGATGG - Intronic
921576175 1:216837504-216837526 AGCTGTGACTATGGGGAAGACGG + Intronic
921836289 1:219782330-219782352 AGTTGTGCCAACAGGAAAGAGGG + Intronic
923234396 1:232018739-232018761 TGGAGGGACAGCAGGGAAGATGG + Intronic
924046898 1:240041101-240041123 AGGGCTTACAACAGGCAAGAAGG + Intronic
924269526 1:242318361-242318383 AGGTGTGACAGCAGAGGAGTCGG - Intronic
924395784 1:243619178-243619200 AGGTGGGAGAAACGGGAAGAGGG + Intronic
1064502481 10:15989251-15989273 AGGTGTGGGAAGAGAGAAGAGGG + Intergenic
1064528587 10:16283907-16283929 AGGTGAGAGATAAGGGAAGAGGG + Intergenic
1064583300 10:16815479-16815501 GGATGTGACAAGAGAGAAGAAGG - Intronic
1064967799 10:21032503-21032525 AGGTGCTGCTACAGGGAAGAAGG - Intronic
1065181450 10:23130227-23130249 AGCTGTGAAATTAGGGAAGACGG - Intergenic
1065954537 10:30682155-30682177 AAGTGTGAAAACAAAGAAGATGG - Intergenic
1066108522 10:32176681-32176703 AGGTGTTAAAAAATGGAAGAGGG + Intergenic
1066640332 10:37548901-37548923 AGGGGTGGCAACTGGGAAGAGGG + Intergenic
1067827889 10:49592563-49592585 AGGTCACACAACAGGGATGAAGG + Intergenic
1068189731 10:53635545-53635567 AGGTGAGAGAGCAGGGAACAAGG + Intergenic
1069047885 10:63762200-63762222 AAGGGTGGCCACAGGGAAGAGGG + Intergenic
1069235918 10:66072971-66072993 ATTTGTGACAACAGGGAATCTGG + Intronic
1069423977 10:68273380-68273402 AGGTGAGACAACTGGGAACAGGG - Intergenic
1070775931 10:79109774-79109796 AGGTGGGAAAACAGTGATGATGG - Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071296431 10:84223734-84223756 AGGTATGAAAACAGAGCAGAGGG + Intronic
1071461415 10:85900309-85900331 AGGTGTAATAACAGGGTAGAAGG + Intronic
1071735542 10:88294957-88294979 AAGTGTGACAAAAGAGAAGGTGG - Intronic
1072686054 10:97537616-97537638 AGGTCTGAAAAGAGGGAGGAGGG + Intronic
1075266915 10:121008848-121008870 AGGAGAGAAAACAGGGCAGAAGG - Intergenic
1075303672 10:121348502-121348524 AGGTGGGGCAAGGGGGAAGAGGG - Intergenic
1075453841 10:122571910-122571932 AGGTGGTACAACAAGAAAGATGG - Intronic
1075615431 10:123887585-123887607 GGTTGTGACAACAGGGGGGAGGG + Intronic
1075675378 10:124292500-124292522 AGGGGTGACAGCAGGTGAGACGG - Intergenic
1075927509 10:126264848-126264870 TGGGGTGAGAACAGGGAAGCAGG - Intronic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1077252090 11:1565223-1565245 AGGTGTGACCACATGGCAGTGGG - Intronic
1077576951 11:3391155-3391177 AGGTGTCACAACATGCAAGATGG + Intergenic
1079646449 11:22869312-22869334 AGGAGTCACACCAGGGTAGAGGG + Intergenic
1079794625 11:24785066-24785088 TAGTGTAACTACAGGGAAGAAGG - Intronic
1083157815 11:60836117-60836139 AAGAGGTACAACAGGGAAGAGGG - Intergenic
1084228892 11:67735945-67735967 AGGTGTCACAACATGCAAGATGG + Intergenic
1084550256 11:69836761-69836783 AGGTATAACAACAGGGACCAGGG + Intergenic
1087129123 11:94653646-94653668 AGGCTTGAGAACAGGTAAGATGG - Intergenic
1089590476 11:119537194-119537216 AGGTGGGACTACAGGGATCAGGG - Intergenic
1089710931 11:120314049-120314071 GGGTGTGACAGCAGGGAGGGAGG + Intronic
1091351064 11:134894627-134894649 AGGTGTCATAACATGGAACACGG + Intergenic
1091446198 12:545560-545582 TGGTGTGACAGCGGGGAAGAAGG + Intronic
1091839687 12:3611935-3611957 AGGTATAAGAACAGGGAAGCAGG + Intronic
1092433548 12:8428011-8428033 AGGTGTCACAACATGCAAGATGG + Intergenic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1095702003 12:45200354-45200376 AGGAGTGAGCACATGGAAGAAGG - Intergenic
1095831650 12:46592911-46592933 AGGTGTCAGAACAGGCAAGGTGG - Intergenic
1095926611 12:47585384-47585406 AGGTTTGACACAAGGAAAGATGG + Intergenic
1096828945 12:54300025-54300047 ATGTGTGAGAACAAAGAAGAGGG + Intronic
1098393314 12:69992303-69992325 AGCTGTGACACCAGAGAATAAGG + Intergenic
1099464077 12:82961016-82961038 AGGTCAAACAACAGGTAAGAAGG - Intronic
1099952193 12:89316541-89316563 AGGAGTGACACCAGGAAACAAGG + Intergenic
1100691983 12:97047936-97047958 AGGGGTGAGAACAGGGAGAATGG - Intergenic
1101288268 12:103338815-103338837 AGGAGTGGGAACAGGAAAGAAGG + Intronic
1101466350 12:104953903-104953925 AGGTGGGGCAAAAGGAAAGAGGG + Intronic
1103030429 12:117607806-117607828 AGGTGTGACAGGAGGGCACAGGG + Intronic
1103152151 12:118650142-118650164 AGGTGTGACAAAAAAGAAGAGGG - Intergenic
1105213615 13:18272159-18272181 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1106310404 13:28549205-28549227 AGGTGAGACAGGAGGGAACAAGG + Intergenic
1106487930 13:30189184-30189206 AGGTCTGAAAAGAAGGAAGATGG + Intergenic
1106703854 13:32259407-32259429 AGGTGTGAAAATAGGGAGGCAGG - Intronic
1107545695 13:41431617-41431639 AGGTGTCACAACATGCAAGATGG + Intergenic
1107547054 13:41443288-41443310 AGGTGTCACAACATGCAAGATGG - Intergenic
1108052564 13:46460767-46460789 AGGTGTCACAACATGCAAGATGG - Intergenic
1109538367 13:63742451-63742473 AGGTGTCACAACATGCAAGATGG - Intergenic
1109545471 13:63837321-63837343 AGGTGTCACAACATGCAAGATGG + Intergenic
1109840408 13:67911576-67911598 AGGTGTCACAACATGCAAGATGG - Intergenic
1110001288 13:70204834-70204856 GGATGGGACTACAGGGAAGAAGG - Intergenic
1110209666 13:72956722-72956744 AGGTGTAAGAACAGAGAAAAGGG - Intronic
1110390667 13:74969821-74969843 AGCTGTGACAACATAGAAAAAGG + Intergenic
1112496361 13:99908263-99908285 AGGTGTGTAAACAGAGCAGATGG - Intergenic
1114616693 14:24072249-24072271 AAGTGTGAAAACAGGGGAGGTGG + Intronic
1114918094 14:27291974-27291996 AGGTGTTGCAACCGGGTAGATGG + Intergenic
1116407942 14:44588284-44588306 ATGAGTGCCTACAGGGAAGAAGG + Intergenic
1116480118 14:45387044-45387066 TGGTGTGGCAACTGGGAGGATGG - Intergenic
1116594152 14:46819095-46819117 GGGTGGGACAAAAAGGAAGAGGG + Intergenic
1116815654 14:49581258-49581280 AAGTGTGACAGAAGGGAAGCTGG - Intronic
1117040333 14:51763444-51763466 AGGTGTCACAACATGCAAGATGG + Intergenic
1117976351 14:61300821-61300843 AAGGTTGACAAAAGGGAAGATGG - Intronic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1118359068 14:65040788-65040810 AGGTGTCAGAACTGGGAAGGTGG + Exonic
1119878594 14:78081422-78081444 AGGTGAGGGAACAGTGAAGAGGG + Intergenic
1120280239 14:82429869-82429891 AGCTGTGACTACAGGGAAGTGGG - Intergenic
1120942151 14:89958673-89958695 AAGTGTGCCAAGTGGGAAGAGGG + Intronic
1121110162 14:91307231-91307253 AGGTGTGACAATAAGCAAGGAGG + Intronic
1121405381 14:93716469-93716491 TGGTGTGACATCACAGAAGATGG - Intergenic
1121494970 14:94385813-94385835 TGATGTGACACCAGGAAAGATGG - Intronic
1121675295 14:95747453-95747475 AGGTGTGACAACAAGAAACGGGG + Intergenic
1121722369 14:96118607-96118629 AGCTGGGAAGACAGGGAAGAAGG - Intergenic
1122023297 14:98857235-98857257 AGGTGGATTAACAGGGAAGAGGG - Intergenic
1122154148 14:99740323-99740345 AGGTGGGACTCCCGGGAAGAGGG - Intronic
1122855044 14:104556079-104556101 AGCTGTGACCCCAGGGCAGATGG - Intronic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1123480421 15:20626011-20626033 ATGTGTGACAACAGGTAACAAGG - Intergenic
1123637587 15:22374354-22374376 ATGTGTGACAACAGGTAACAAGG + Intergenic
1123878942 15:24656404-24656426 ATGTGTGTCAACAGGAAAGGCGG - Intergenic
1126584004 15:50265549-50265571 AGGAGTAGCAGCAGGGAAGAGGG + Intronic
1128360353 15:66957405-66957427 AGGTGTGAGAGCAGGTATGAAGG - Intergenic
1129324538 15:74793262-74793284 GGGTCTGGAAACAGGGAAGAGGG - Intronic
1129381819 15:75172620-75172642 GGGTGTCTCACCAGGGAAGAGGG - Intergenic
1129831434 15:78673638-78673660 CGGTGTGACTTCTGGGAAGAAGG - Intronic
1129905006 15:79180428-79180450 AGGTGTGACGAAGGGGACGATGG - Intergenic
1130243195 15:82217703-82217725 AGGTGTGAACACTGGGAAGCAGG - Intronic
1130298056 15:82661037-82661059 AGGAGAGACAACAAGGCAGAAGG - Intronic
1130457257 15:84123587-84123609 AGGTGTGAACACCGGGAAGCAGG + Intergenic
1131516451 15:93080745-93080767 AGGTGTGAAAGAAGGAAAGAGGG - Intronic
1131611712 15:93971249-93971271 GGGTTTGAAAAAAGGGAAGAAGG + Intergenic
1131675294 15:94665095-94665117 TGGGGTGGTAACAGGGAAGACGG - Intergenic
1131698359 15:94904554-94904576 AGCTGGGACTACAGGCAAGAAGG + Intergenic
1132048452 15:98586217-98586239 AGGTGTGATTACAGTGAACAAGG - Intergenic
1132715119 16:1286283-1286305 AGGGGTGTCCACAAGGAAGACGG + Intergenic
1132768226 16:1545899-1545921 GGGTGTCAGAGCAGGGAAGAGGG - Intronic
1133712638 16:8415996-8416018 AGCTGCGACAACAGAGAGGAAGG + Intergenic
1134233879 16:12450585-12450607 CGGTGTGAGAGAAGGGAAGACGG + Intronic
1134449773 16:14356065-14356087 AGGGATGACAACATGGAACAGGG + Intergenic
1136552652 16:30989819-30989841 AGGGGTGGGAACAGGGAGGAGGG + Exonic
1137032254 16:35534178-35534200 AGGAGTGGGAACAGGAAAGATGG + Intergenic
1138786216 16:59849908-59849930 ATGTGAGGCAGCAGGGAAGAAGG - Intergenic
1139561932 16:67748663-67748685 AGGTGTTAGAAAAGGGGAGAGGG + Intronic
1140707424 16:77643777-77643799 GGGTGAGACAACAGGATAGAGGG - Intergenic
1141324379 16:83041967-83041989 ACGTGTGAGATCAGGAAAGAGGG - Intronic
1141988373 16:87594565-87594587 TGGGGTGACAACAGGGAGGCAGG + Intergenic
1142561311 17:811134-811156 AGGTGGCACAGGAGGGAAGAAGG + Intronic
1143731436 17:8885043-8885065 AGGTGTGATCACAGCGGAGATGG - Intronic
1143731450 17:8885092-8885114 AGGTGTGATCACAGCGGAGATGG - Intronic
1144223927 17:13126335-13126357 ATATATGACAAAAGGGAAGATGG - Intergenic
1144401884 17:14912495-14912517 AGGGGGTACATCAGGGAAGATGG + Intergenic
1144969053 17:19095681-19095703 AGGTGTGCCAACAGGTAAGCTGG + Intronic
1144978863 17:19156385-19156407 AGGTGTGCCAACAGGTAAGCTGG - Intronic
1144989359 17:19221847-19221869 AGGTGTGCCAACAGGTAAGCTGG + Intronic
1146652168 17:34613654-34613676 AGGGCTGAGAACAGGGGAGAGGG - Intronic
1147516879 17:41126799-41126821 AGATGAGAAAACAGGAAAGAGGG + Intergenic
1147861560 17:43527086-43527108 AGATGTGACAACAGGTGGGAGGG - Intronic
1148619478 17:49023543-49023565 GGGTTTGAAAACAGGGAAGGGGG - Intronic
1148729699 17:49825915-49825937 CTGTGTGCCAACATGGAAGAAGG - Intronic
1149239322 17:54630714-54630736 AGGTCTGAGAGAAGGGAAGATGG - Intergenic
1149304950 17:55338681-55338703 AGTTGTCACAACAGAGGAGAAGG - Intergenic
1150847280 17:68672283-68672305 AGGTTTGGGAACAGGGAATAAGG + Intergenic
1151168487 17:72225309-72225331 AGTAGTGACAACAGGGAACAAGG + Intergenic
1151887116 17:76929645-76929667 AGTGGGGACAAAAGGGAAGAGGG + Intronic
1152017816 17:77763398-77763420 AGTTAAGACAACAGGGAACAGGG + Intergenic
1152549852 17:81023844-81023866 GGGTGTGACATCAGGGACAAGGG - Intergenic
1153018593 18:606537-606559 AGGGGTGAGGACAAGGAAGATGG - Intronic
1155542016 18:26878697-26878719 GGGTGTGAAAGCATGGAAGACGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156384500 18:36593409-36593431 AGGTATGACAGCAGAGGAGAGGG + Intronic
1156952298 18:42917046-42917068 GGGTGTGACATCAGGCAAGGAGG + Intronic
1157371362 18:47115283-47115305 AGGTATTACAAGAGGAAAGATGG - Exonic
1157431068 18:47627137-47627159 ACTTGTGCCAACAGGGCAGAAGG - Intergenic
1160347130 18:78141342-78141364 AGTTGTGACAACTGGCGAGATGG + Intergenic
1161913940 19:7214944-7214966 AGCTGGGAAGACAGGGAAGAAGG - Intronic
1162222705 19:9191784-9191806 AGGTGTCACAACAGGCAAGGTGG - Intergenic
1162463120 19:10824968-10824990 TGGTGGGACAATAGGGCAGATGG + Intronic
1163070995 19:14841301-14841323 AGGTGTCAGAACAGGCAAGGTGG + Exonic
1163073273 19:14864139-14864161 AGGTGTCAGAACAGGCAAGGTGG + Intergenic
1163074857 19:14880779-14880801 AGGTGTCAGAACAGGCAAGGTGG + Exonic
1163079556 19:14927666-14927688 AGGTGTCAGAACAGGCAAGGTGG - Intergenic
1163401683 19:17097621-17097643 GGGAGTGGCGACAGGGAAGAAGG - Intronic
1163434215 19:17285589-17285611 AGGTGTGAGGACAGGGATCAGGG + Exonic
1165172965 19:33906415-33906437 AGGGGAGAGAATAGGGAAGAGGG + Intergenic
1166283172 19:41808716-41808738 AGGTGTGCAGTCAGGGAAGAAGG - Intronic
1167436520 19:49481563-49481585 AGGTGGGCCAGGAGGGAAGAAGG + Intronic
1167903132 19:52637266-52637288 AGGGGGTATAACAGGGAAGACGG - Intronic
1167952165 19:53036587-53036609 GGGGGTGTAAACAGGGAAGAGGG - Intergenic
1168497831 19:56869127-56869149 CCTTCTGACAACAGGGAAGAAGG + Intergenic
925866124 2:8227635-8227657 AGTTGTGAAAACAGGAAAGCTGG + Intergenic
926176275 2:10595105-10595127 AGGTAGGACTACAGGCAAGAGGG + Intronic
926307665 2:11650680-11650702 AGTTGTGACAAAAGGGAGCATGG - Intergenic
926559017 2:14394814-14394836 TGGAGGGACACCAGGGAAGATGG + Intergenic
927193287 2:20531673-20531695 AGTTGTGAGAACAGGGAGGGTGG + Intergenic
927214697 2:20661757-20661779 AGGAGAGGCAACAGAGAAGAAGG - Intergenic
927444011 2:23141915-23141937 AGGTGGGAGAATGGGGAAGAAGG + Intergenic
927615462 2:24589292-24589314 ATCTGTGACACCAGGAAAGATGG - Intronic
927703122 2:25280468-25280490 GAGAGTGAGAACAGGGAAGAAGG - Intronic
927846385 2:26474492-26474514 AGGTGGGACTGCAGGGAAGAGGG - Exonic
928593866 2:32842454-32842476 AGGGGTCAGAACAAGGAAGAAGG + Intergenic
928704468 2:33933259-33933281 AGGTGAGAAAGAAGGGAAGAAGG - Intergenic
932351756 2:71038293-71038315 AGGTGTCACAACATGCAAGATGG - Intergenic
932631163 2:73344644-73344666 TGGTGGGACAAGAGGCAAGAGGG - Intergenic
932733418 2:74236467-74236489 AGGTGTGACAGGAAGGAAGAGGG - Intronic
933689437 2:85168398-85168420 AAGTGTGGGAACAGTGAAGATGG + Intronic
933780478 2:85797228-85797250 GGGTGTGACAACAGGCAAAGGGG - Intergenic
933922942 2:87066776-87066798 AGGTTTGACTAGAGGCAAGAAGG - Intergenic
934300713 2:91774587-91774609 AGGTGTGACAACAGGGAAGAGGG - Intergenic
935648920 2:105365549-105365571 AGGGGAGAGAACAGGGAAGAGGG + Intronic
935688561 2:105709667-105709689 AGGTGTGACAACACAAAAGAAGG - Intergenic
936801302 2:116269660-116269682 AGGCATGACTACATGGAAGAAGG - Intergenic
936941473 2:117888742-117888764 AGGAGAGACAAGAGGAAAGAGGG + Intergenic
937055689 2:118934411-118934433 AGGAGTGATGACAGGGAAAATGG - Intergenic
937269977 2:120643490-120643512 AGGTGTGACAACAGGGGCAGAGG - Intergenic
937843566 2:126552608-126552630 AGGTGTGAGATCACAGAAGAGGG + Intergenic
940871320 2:158862901-158862923 AGGTGCCACAACATGCAAGACGG - Intronic
940961904 2:159795762-159795784 AGAGATGACATCAGGGAAGAAGG + Intronic
946051066 2:216863072-216863094 AGCTGAGATCACAGGGAAGAAGG + Intergenic
946498746 2:220222794-220222816 AGGTGTGAGAAAAGGGTAGAAGG - Intergenic
947580603 2:231314636-231314658 GGTTGTGACAACTGGGAAGAGGG - Intronic
948152108 2:235752550-235752572 AGCTGTGACAGCAGAGATGAGGG + Intronic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948621399 2:239237094-239237116 AGGTGTGCAGACAGGGAAGGAGG + Intronic
948914002 2:241021057-241021079 AGGTGTTCCCATAGGGAAGAAGG - Intronic
1169105200 20:2988494-2988516 TGGTGTATCAGCAGGGAAGAAGG + Intronic
1169314441 20:4576791-4576813 AGGTGTGAAAACAAGGAGGTGGG + Intergenic
1169509145 20:6245109-6245131 AGGTGTGGCAACAGGAAAGGAGG - Intergenic
1169899135 20:10535118-10535140 AGGAGAGAGACCAGGGAAGACGG + Intronic
1170251426 20:14288064-14288086 AGGTGTGACCACAGGGAGGTAGG + Intronic
1171229774 20:23475129-23475151 AGGTCTGGCAGCAGGGAAAATGG + Intergenic
1171378996 20:24718941-24718963 AGGGGTGGCAGCAGGGAGGAGGG - Intergenic
1171993782 20:31716923-31716945 AGGTCTGCCAACTGGGAACAAGG + Intronic
1172813609 20:37669449-37669471 AGGTGAGAAGACAGGGAAAAAGG - Intergenic
1173015744 20:39223976-39223998 AGCTGTGTCACCAGGGAGGAAGG - Intergenic
1173398370 20:42702056-42702078 AAGTGTGACAAGTGGGAAGTGGG - Intronic
1173678490 20:44859109-44859131 AGGTATGACACCAGGGGAGAAGG + Intergenic
1173697455 20:45031243-45031265 AGCTGAGACATCAGTGAAGAGGG + Intronic
1174038592 20:47683325-47683347 AGGGGTGACAAGAGGCAGGAAGG - Intronic
1176081845 20:63277386-63277408 AGCTGTCACAACAGCAAAGAAGG - Intronic
1176126958 20:63479890-63479912 CTGTGTGAGACCAGGGAAGAGGG - Intergenic
1178443941 21:32621656-32621678 AGGTGTCACAACATGCAAGATGG - Intergenic
1178867462 21:36341465-36341487 AGATGAGATAACAGGGAAGAAGG + Exonic
1179346357 21:40561205-40561227 AGGTGTGGTAACAGTGATGATGG + Intronic
1179492268 21:41748441-41748463 AGGTGTGACAACTTTGAGGATGG + Intronic
1180022229 21:45135780-45135802 AGGTGTGGCCACAGTCAAGAGGG + Intronic
1180816449 22:18792550-18792572 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1181202636 22:21226882-21226904 AGGTGTGACAACAGGGAAGAGGG + Intronic
1181699067 22:24609723-24609745 AGGTGTGACAACAGGGAAGAGGG - Intronic
1181890963 22:26063076-26063098 CGGTGTAACAGCAGAGAAGATGG - Intergenic
1182624907 22:31638461-31638483 AGTGGGGAGAACAGGGAAGAGGG + Intronic
1182964373 22:34507443-34507465 AGGTCTGGCAACAGGGTAGCAGG - Intergenic
1185293268 22:50039397-50039419 AGAAGAGAGAACAGGGAAGAAGG + Intronic
1203224277 22_KI270731v1_random:68531-68553 AGGTGTGACAACAGGGAAGAGGG - Intergenic
1203266549 22_KI270734v1_random:18261-18283 AGGTGTGACAACAGGGAAGAGGG + Intergenic
949545828 3:5071433-5071455 AAGTGTGCCAACAAGGATGAAGG - Intergenic
950221455 3:11199555-11199577 AGGTGTTGCAGCAGGGAAGTGGG - Intronic
951469796 3:23044094-23044116 AGTTGTGAAAACAGCAAAGATGG - Intergenic
951524840 3:23643944-23643966 AGGTGAGAGAAGAGGGAATACGG - Intergenic
952094979 3:29940010-29940032 TGGTTTGACTACAGGGAAAATGG - Intronic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
953605314 3:44409872-44409894 AGGTGGGACAAAAGGGACCAGGG + Intergenic
953968188 3:47326401-47326423 AGCTGTGTCAGCAAGGAAGAAGG + Intronic
955133807 3:56196158-56196180 AGCTGCTACACCAGGGAAGATGG + Intronic
955643886 3:61115490-61115512 AGGGGTGACAGCAGGAAGGAAGG + Intronic
955744713 3:62128771-62128793 AAATATGACAACAGTGAAGAGGG - Intronic
956684514 3:71812418-71812440 GGGAGTCAAAACAGGGAAGAGGG + Intergenic
956706585 3:72004403-72004425 AGCTGTGATACCAGGGAAAACGG + Intergenic
957042644 3:75348183-75348205 AGGTGTCACAACATGTGAGATGG + Intergenic
957045477 3:75370762-75370784 AGATGTCACAACATGCAAGATGG + Intergenic
957608141 3:82431101-82431123 AGGAGTGACATCAGCCAAGATGG + Intergenic
959466877 3:106699214-106699236 AGGTGTGACTAGAAGGGAGATGG + Intergenic
960898905 3:122534390-122534412 AGGTTTTACAACATGGAATAGGG + Intronic
961274024 3:125712697-125712719 AGGTGTCACAACATGCAAGATGG - Intergenic
961276907 3:125734855-125734877 AGGTGTCACAACATGCAAGATGG - Intergenic
961651128 3:128417201-128417223 AGGGTTTACAACAGAGAAGAGGG - Intergenic
961718349 3:128874612-128874634 AAGTGTGTCAACAGGGTGGAAGG + Intergenic
961877516 3:130034886-130034908 AGGTGTCACAACATGCAAGATGG + Intergenic
961903861 3:130242181-130242203 AGGTGAGTAAAGAGGGAAGAAGG - Intergenic
962202817 3:133414844-133414866 AGGTGTGAGTAGATGGAAGAGGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962452849 3:135535288-135535310 AGGTGGGACAAGAGGGAAAGAGG + Intergenic
963156290 3:142100675-142100697 AGGTGTGAAGAAAGGGAAGGAGG - Intronic
963929767 3:150991702-150991724 AGCTGTGAAAACGGGGAACAGGG - Intergenic
964544631 3:157820374-157820396 AGGTCTGAAAACTTGGAAGAAGG - Intergenic
965742124 3:171886520-171886542 ATGTGTGGCAGAAGGGAAGAAGG - Intronic
966910217 3:184555457-184555479 AGGGGGGACAAAAGGGGAGAAGG + Intronic
966910577 3:184557424-184557446 TGGTGAGAAAACAGGGAAGCAGG + Intronic
967286084 3:187871923-187871945 AGAAGAGACAACAGGGAAGAGGG + Intergenic
968989757 4:3901922-3901944 AGGTGTCACAACATGCAAGATGG + Intergenic
969026204 4:4174670-4174692 AGGTGTCACAACATGCAAGATGG + Intergenic
969212603 4:5699195-5699217 AGGTGTGGGAAGAGGGAAAATGG + Intronic
969787378 4:9469609-9469631 AGGTGTCACAACATGCAAGATGG - Intergenic
969825555 4:9755437-9755459 AGGTGTCACAACATGCAAGATGG - Intergenic
970907615 4:21235400-21235422 ATGTTTGACAAAAGGGAAGAAGG - Intronic
972746345 4:41935782-41935804 AGGTGGGAGAAGAGGAAAGAAGG - Intronic
974542469 4:63255592-63255614 AGGTGTGAAAACAGGCATTAGGG + Intergenic
975066038 4:70064573-70064595 AGGTGGGACAACTGGAAACAGGG + Intergenic
977443387 4:97098791-97098813 AGGTGGGAAAACAGGGACTATGG - Intergenic
977655131 4:99513038-99513060 TTTTGTGACAACAGTGAAGAGGG + Exonic
979199099 4:117955218-117955240 AGGTGTGCCTACAAGGAAAATGG + Intergenic
980084594 4:128378233-128378255 AGGAGAGAGAAGAGGGAAGAAGG + Intergenic
983884340 4:172963596-172963618 AGGTGGGACAACAGGGAGCCAGG - Intronic
984225692 4:177032286-177032308 AGGTGTGACAAAAGGCAAAGGGG + Intergenic
984844845 4:184100525-184100547 AGGTGAGAAAAAAGGGTAGAGGG + Intronic
985573118 5:661230-661252 AGGGGTGACACCAGGAGAGAGGG - Exonic
985993669 5:3584497-3584519 AGGGGGGACAAGAGGAAAGAAGG + Intergenic
986831001 5:11578202-11578224 AGGGCTGACATCAGGTAAGAGGG + Intronic
987400339 5:17468895-17468917 AGATGTGAAATCAGGGGAGAGGG + Intergenic
988886710 5:35565683-35565705 AGATTTTACAACAGGGAAAAGGG + Intergenic
991184989 5:63795944-63795966 AGGAGTGAGAACAGTGAAGGAGG + Intergenic
991571283 5:68055893-68055915 AGGTGAGACAAGGGGTAAGATGG - Intergenic
992003700 5:72458571-72458593 AGGGGTGCGAACAGGGAAGCAGG + Intronic
992140614 5:73793457-73793479 AGGAGTGACAAAACGGAATAGGG + Intronic
992229468 5:74649673-74649695 AGGTGTGACAAATGAGAAGCTGG + Intronic
993141205 5:84036193-84036215 AGGGATGGCAACAGGGAACATGG + Intronic
993804200 5:92384149-92384171 AGTTGTCACAACTTGGAAGAAGG + Intergenic
994036652 5:95209399-95209421 AGGTGTGACAGAAGGAGAGAGGG - Intronic
996226646 5:121007427-121007449 TGGTGGAACAACAAGGAAGATGG + Intergenic
997194971 5:131973290-131973312 TCGTGGGACCACAGGGAAGATGG + Exonic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
998376832 5:141696585-141696607 AGCTGTGAGAACAAGGAAGGAGG - Intergenic
998818294 5:146035400-146035422 AGGTGTCACTTCAGGGGAGATGG - Intronic
998887996 5:146714834-146714856 AGGTGTGAGGTCAGGGGAGAGGG - Intronic
999770627 5:154773036-154773058 TGTTGGGACAACTGGGAAGAGGG + Intronic
1000710596 5:164571075-164571097 ATGTGTAACATCAGCGAAGATGG - Intergenic
1001404650 5:171467363-171467385 AGTTGTGACAACTGGGGAGTTGG - Intergenic
1001753776 5:174150776-174150798 GGGCTTGACAAAAGGGAAGAGGG + Intronic
1003258027 6:4490793-4490815 AGTTGTGAAGAAAGGGAAGAAGG + Intergenic
1004026339 6:11823006-11823028 AGGTGAGACAAGATGGAAGGAGG - Intergenic
1004653066 6:17630718-17630740 AGGGGAGACAAGAGGGGAGAGGG + Intronic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1005855910 6:29863314-29863336 AGGTGATACAATAGGAAAGAAGG + Intergenic
1006028592 6:31162819-31162841 GGGAATGACTACAGGGAAGAAGG + Exonic
1006174718 6:32115012-32115034 ATGTGAGTCAACAGGAAAGATGG - Intronic
1006622401 6:35374936-35374958 AGGAGTGACATTAGGGAGGAAGG - Intronic
1007159082 6:39774453-39774475 AGGTTTGACCACTTGGAAGATGG + Intergenic
1007386615 6:41524368-41524390 AGGAGTGAAAAGGGGGAAGAGGG + Intergenic
1007530199 6:42535352-42535374 AGGTCTGAGAAGAGGAAAGAAGG - Intergenic
1007811787 6:44491472-44491494 TGGTCTGGCAACTGGGAAGATGG - Intergenic
1007905163 6:45452785-45452807 AGGTGACACAACAAGGAAGAAGG + Intronic
1008418070 6:51266390-51266412 ATGTTTGACAACATGGTAGAAGG + Intergenic
1010253142 6:73729182-73729204 AAGAGAGACAACAGGGAAGAAGG + Intronic
1010906061 6:81490565-81490587 AGGTGTCACAAAAGGTAAGTGGG + Intergenic
1011203797 6:84869182-84869204 AGGTGTGACAAAGGAGAAGAAGG - Intergenic
1012722595 6:102764943-102764965 AGGTATGACAACAGACAATATGG + Intergenic
1013453775 6:110311101-110311123 AGGAGTGAGAACAGGGAAGGTGG - Intronic
1015414648 6:132934557-132934579 AGGGGAGAAGACAGGGAAGAAGG + Intergenic
1015838166 6:137444842-137444864 AGGTTGGACAACTGGGTAGAAGG - Intergenic
1016344799 6:143101562-143101584 AGCTCTGAAAACTGGGAAGACGG + Intronic
1016752177 6:147642905-147642927 TGGGGTGACAACAGTGCAGATGG - Intronic
1019018766 6:168900484-168900506 AGGGGTGAGAAGAGGGAAGCAGG + Intergenic
1019018815 6:168900664-168900686 AGGAGTGAGAAGAGGGAAGCAGG + Intergenic
1019085603 6:169473307-169473329 AAGAGTGACAAAAGGGAAGGAGG + Intronic
1019138849 6:169930311-169930333 AGGGGTGAGAAAAGTGAAGAGGG - Intergenic
1020305984 7:6835173-6835195 AGGTGTCACAACATGCAAGATGG + Intergenic
1020312570 7:6879970-6879992 AGGTGTCACAACATGCAAGATGG + Intergenic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1021873678 7:25028904-25028926 AGATGTGTAAACAGAGAAGATGG + Intergenic
1022054545 7:26717000-26717022 AGGAGTGAACACAGGAAAGATGG - Intronic
1023238206 7:38113503-38113525 ATGTGTGAGAACAGGAAAGTAGG - Intergenic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1024358829 7:48446410-48446432 AGGTCTCACATCAGGGAATAAGG - Intronic
1024446402 7:49484547-49484569 ATGAGTGAATACAGGGAAGACGG + Intergenic
1026602468 7:71787920-71787942 AGGTGTGGGAAGAAGGAAGAGGG + Intronic
1028156153 7:87431850-87431872 AAGTGTGAAAACACTGAAGAAGG - Intronic
1029014620 7:97302611-97302633 AGGTGTGACAACTCTGAGGAAGG - Intergenic
1029080121 7:97966442-97966464 AGGTGTCACAACATGCAAGATGG + Intergenic
1029606452 7:101602037-101602059 ATGTGTGAAAACACTGAAGATGG + Intergenic
1030735519 7:113043429-113043451 AGGTGTGACAAACAGGAAGAAGG + Intergenic
1031491474 7:122394859-122394881 AGGAGTGAAAACAGAGAAAAAGG + Intronic
1031548237 7:123076798-123076820 CCATGTGATAACAGGGAAGACGG + Intergenic
1032115174 7:129110844-129110866 AGGTGTCACTACAGGCAACATGG - Intergenic
1032566534 7:132952833-132952855 AATTATGACAACAGGGAAGGTGG + Intronic
1033470699 7:141646475-141646497 AGCTTTGTTAACAGGGAAGAGGG - Intronic
1035421632 7:158734232-158734254 AGGTATGACCTCACGGAAGATGG - Exonic
1036165714 8:6430965-6430987 AGGTGTGTCCACAGGGCAGGAGG + Intronic
1036426485 8:8649635-8649657 GGGTGTGAGAAAGGGGAAGAGGG - Intergenic
1036744367 8:11393595-11393617 AGGTGTGGGAACAGGGCAGATGG - Intronic
1036818515 8:11920172-11920194 AGGTGTCACAACATGCAATATGG + Intergenic
1036904505 8:12696644-12696666 AGGTGTCGCAACATGCAAGATGG + Intergenic
1039419175 8:37421286-37421308 AGGTGTGGCAGCAGGGAGCAGGG - Intergenic
1039980583 8:42406723-42406745 ACATGTGACAAAAAGGAAGAGGG + Intergenic
1040417606 8:47209015-47209037 AGGTGGGACAACTGGAAAGGTGG - Intergenic
1041946984 8:63455979-63456001 AAGTAGGACAAAAGGGAAGAAGG - Intergenic
1043159150 8:76824022-76824044 AGGTGTGATAGCAAGAAAGAAGG + Intronic
1044120894 8:88393635-88393657 AGGTGATACAACAGGTAATAAGG - Intergenic
1044271296 8:90247244-90247266 GAGTGTGAAAACAGGGAAGTTGG - Intergenic
1045844427 8:106616991-106617013 AAATGTGATGACAGGGAAGAAGG + Intronic
1045949823 8:107838919-107838941 AGATTTGGCAACAGGGAAGTTGG - Intergenic
1047711176 8:127553896-127553918 AGGTGTGGGAGCAGGTAAGATGG + Intergenic
1048321904 8:133406574-133406596 AGGTCACACAGCAGGGAAGAGGG - Intergenic
1048865796 8:138760682-138760704 TGGTGAGGCACCAGGGAAGAGGG + Intronic
1048979320 8:139694655-139694677 TGGTGTGACAAGAGGGATGCTGG - Intronic
1049491022 8:142902285-142902307 AGATGTGGGAACAGGGAAGGGGG + Intronic
1049646185 8:143736805-143736827 GGGAGTGACAACAGTGAAGGCGG - Intergenic
1049691001 8:143958848-143958870 AGGTGTCACCACAGGAAACATGG + Intronic
1051854906 9:21552994-21553016 AGGTGTGATAATAATGAAGAGGG + Intergenic
1052288565 9:26816724-26816746 AAGTGTGATAACATGGATGAAGG + Intergenic
1052573795 9:30265014-30265036 AGGAGTGACAACAATAAAGAGGG - Intergenic
1056223519 9:84472646-84472668 AGTTGTGACTACAGGGTAGCAGG - Intergenic
1056864374 9:90216586-90216608 AGGTGTCACAACATGCAAGATGG - Intergenic
1056915527 9:90742852-90742874 AGGTGTCACAACATGCAAGATGG + Intergenic
1057109525 9:92454713-92454735 AGGGGTGACAACACTGAACAAGG - Intronic
1057246636 9:93460977-93460999 AGGTGTAACAAGAGGAAAGGTGG - Intronic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057762483 9:97888083-97888105 AAGAGTGACAAGAGGGAAGGAGG - Intergenic
1058847519 9:108975593-108975615 AGCTGGGAAAACAGGGAACAGGG + Intronic
1060116675 9:120946946-120946968 AGGTGTGACGGGAGGAAAGAAGG - Intergenic
1061074235 9:128331474-128331496 AGGAGTTACCACAGTGAAGATGG + Intronic
1062552430 9:137095740-137095762 AGGTGTGGAAACAGGGAACAGGG + Intronic
1185499350 X:585156-585178 AGGAGGGAGAAAAGGGAAGAGGG + Intergenic
1187006276 X:15235747-15235769 AGGACTAACAACAGGGAACAAGG + Intronic
1187904633 X:24054565-24054587 GGGTGTGGGAACAGAGAAGAGGG - Intergenic
1190022227 X:46889812-46889834 ATGTTTGAAAACTGGGAAGAGGG + Intronic
1194142849 X:90226731-90226753 AGGAGAGTCAACAAGGAAGACGG + Intergenic
1194983165 X:100461042-100461064 AGGTCTGAAAACAAGGAAAAGGG - Intergenic
1196329181 X:114449003-114449025 AGGAGTGACATCAGTGAAAATGG + Intergenic
1198263470 X:134987612-134987634 GGCTGTGACAGCAAGGAAGAGGG - Intergenic
1200488607 Y:3796054-3796076 AGGAGAGTCAACAAGGAAGATGG + Intergenic
1202039732 Y:20669066-20669088 AGAGGTGTCTACAGGGAAGAGGG - Intergenic