ID: 1203267169

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:22910-22932
Sequence CCTTCTTTGCAGGAGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203267169_1203267176 -7 Left 1203267169 22_KI270734v1_random:22910-22932 CCATCCATCTCCTGCAAAGAAGG No data
Right 1203267176 22_KI270734v1_random:22926-22948 AAGAAGGCTGGAGGCAGGTCAGG No data
1203267169_1203267177 -6 Left 1203267169 22_KI270734v1_random:22910-22932 CCATCCATCTCCTGCAAAGAAGG No data
Right 1203267177 22_KI270734v1_random:22927-22949 AGAAGGCTGGAGGCAGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203267169 Original CRISPR CCTTCTTTGCAGGAGATGGA TGG (reversed) Intergenic
No off target data available for this crispr