ID: 1203267177

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:22927-22949
Sequence AGAAGGCTGGAGGCAGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203267167_1203267177 -4 Left 1203267167 22_KI270734v1_random:22908-22930 CCCCATCCATCTCCTGCAAAGAA No data
Right 1203267177 22_KI270734v1_random:22927-22949 AGAAGGCTGGAGGCAGGTCAGGG No data
1203267171_1203267177 -10 Left 1203267171 22_KI270734v1_random:22914-22936 CCATCTCCTGCAAAGAAGGCTGG No data
Right 1203267177 22_KI270734v1_random:22927-22949 AGAAGGCTGGAGGCAGGTCAGGG No data
1203267166_1203267177 -3 Left 1203267166 22_KI270734v1_random:22907-22929 CCCCCATCCATCTCCTGCAAAGA No data
Right 1203267177 22_KI270734v1_random:22927-22949 AGAAGGCTGGAGGCAGGTCAGGG No data
1203267168_1203267177 -5 Left 1203267168 22_KI270734v1_random:22909-22931 CCCATCCATCTCCTGCAAAGAAG No data
Right 1203267177 22_KI270734v1_random:22927-22949 AGAAGGCTGGAGGCAGGTCAGGG No data
1203267165_1203267177 1 Left 1203267165 22_KI270734v1_random:22903-22925 CCAACCCCCATCCATCTCCTGCA No data
Right 1203267177 22_KI270734v1_random:22927-22949 AGAAGGCTGGAGGCAGGTCAGGG No data
1203267169_1203267177 -6 Left 1203267169 22_KI270734v1_random:22910-22932 CCATCCATCTCCTGCAAAGAAGG No data
Right 1203267177 22_KI270734v1_random:22927-22949 AGAAGGCTGGAGGCAGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203267177 Original CRISPR AGAAGGCTGGAGGCAGGTCA GGG Intergenic
No off target data available for this crispr