ID: 1203269666

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:42421-42443
Sequence TATCCAAGGCTTCTAAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203269661_1203269666 10 Left 1203269661 22_KI270734v1_random:42388-42410 CCAATCACATCAAGTCCAAACTC No data
Right 1203269666 22_KI270734v1_random:42421-42443 TATCCAAGGCTTCTAAAGTCTGG No data
1203269663_1203269666 -5 Left 1203269663 22_KI270734v1_random:42403-42425 CCAAACTCCGTGTCTTGGTATCC No data
Right 1203269666 22_KI270734v1_random:42421-42443 TATCCAAGGCTTCTAAAGTCTGG No data
1203269659_1203269666 27 Left 1203269659 22_KI270734v1_random:42371-42393 CCGGAGATTCCACTTTGCCAATC No data
Right 1203269666 22_KI270734v1_random:42421-42443 TATCCAAGGCTTCTAAAGTCTGG No data
1203269660_1203269666 18 Left 1203269660 22_KI270734v1_random:42380-42402 CCACTTTGCCAATCACATCAAGT No data
Right 1203269666 22_KI270734v1_random:42421-42443 TATCCAAGGCTTCTAAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203269666 Original CRISPR TATCCAAGGCTTCTAAAGTC TGG Intergenic
No off target data available for this crispr