ID: 1203269666 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22_KI270734v1_random:42421-42443 |
| Sequence | TATCCAAGGCTTCTAAAGTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1203269661_1203269666 | 10 | Left | 1203269661 | 22_KI270734v1_random:42388-42410 | CCAATCACATCAAGTCCAAACTC | No data | ||
| Right | 1203269666 | 22_KI270734v1_random:42421-42443 | TATCCAAGGCTTCTAAAGTCTGG | No data | ||||
| 1203269663_1203269666 | -5 | Left | 1203269663 | 22_KI270734v1_random:42403-42425 | CCAAACTCCGTGTCTTGGTATCC | No data | ||
| Right | 1203269666 | 22_KI270734v1_random:42421-42443 | TATCCAAGGCTTCTAAAGTCTGG | No data | ||||
| 1203269659_1203269666 | 27 | Left | 1203269659 | 22_KI270734v1_random:42371-42393 | CCGGAGATTCCACTTTGCCAATC | No data | ||
| Right | 1203269666 | 22_KI270734v1_random:42421-42443 | TATCCAAGGCTTCTAAAGTCTGG | No data | ||||
| 1203269660_1203269666 | 18 | Left | 1203269660 | 22_KI270734v1_random:42380-42402 | CCACTTTGCCAATCACATCAAGT | No data | ||
| Right | 1203269666 | 22_KI270734v1_random:42421-42443 | TATCCAAGGCTTCTAAAGTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1203269666 | Original CRISPR | TATCCAAGGCTTCTAAAGTC TGG | Intergenic | ||
| No off target data available for this crispr | |||||