ID: 1203270448

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:48563-48585
Sequence GAACCAAGGTGACGGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203270442_1203270448 8 Left 1203270442 22_KI270734v1_random:48532-48554 CCCACGTCACCCACAGGTGAATC No data
Right 1203270448 22_KI270734v1_random:48563-48585 GAACCAAGGTGACGGCAGAGAGG No data
1203270440_1203270448 27 Left 1203270440 22_KI270734v1_random:48513-48535 CCATGGGCTGCAAGTGGGTCCCA No data
Right 1203270448 22_KI270734v1_random:48563-48585 GAACCAAGGTGACGGCAGAGAGG No data
1203270445_1203270448 -2 Left 1203270445 22_KI270734v1_random:48542-48564 CCACAGGTGAATCTTAATTATGA No data
Right 1203270448 22_KI270734v1_random:48563-48585 GAACCAAGGTGACGGCAGAGAGG No data
1203270444_1203270448 -1 Left 1203270444 22_KI270734v1_random:48541-48563 CCCACAGGTGAATCTTAATTATG No data
Right 1203270448 22_KI270734v1_random:48563-48585 GAACCAAGGTGACGGCAGAGAGG No data
1203270443_1203270448 7 Left 1203270443 22_KI270734v1_random:48533-48555 CCACGTCACCCACAGGTGAATCT No data
Right 1203270448 22_KI270734v1_random:48563-48585 GAACCAAGGTGACGGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203270448 Original CRISPR GAACCAAGGTGACGGCAGAG AGG Intergenic
No off target data available for this crispr