ID: 1203271868

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:59472-59494
Sequence CCCCACGCGCCGATTTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203271868_1203271879 21 Left 1203271868 22_KI270734v1_random:59472-59494 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1203271879 22_KI270734v1_random:59516-59538 GAGAGGGCGGGAGAGCTCGTGGG No data
1203271868_1203271881 29 Left 1203271868 22_KI270734v1_random:59472-59494 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1203271881 22_KI270734v1_random:59524-59546 GGGAGAGCTCGTGGGGTGCGAGG No data
1203271868_1203271880 22 Left 1203271868 22_KI270734v1_random:59472-59494 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1203271880 22_KI270734v1_random:59517-59539 AGAGGGCGGGAGAGCTCGTGGGG No data
1203271868_1203271874 4 Left 1203271868 22_KI270734v1_random:59472-59494 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1203271874 22_KI270734v1_random:59499-59521 GTGCTCGAGCTGAGCGCGAGAGG No data
1203271868_1203271875 5 Left 1203271868 22_KI270734v1_random:59472-59494 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1203271875 22_KI270734v1_random:59500-59522 TGCTCGAGCTGAGCGCGAGAGGG No data
1203271868_1203271878 20 Left 1203271868 22_KI270734v1_random:59472-59494 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1203271878 22_KI270734v1_random:59515-59537 CGAGAGGGCGGGAGAGCTCGTGG No data
1203271868_1203271882 30 Left 1203271868 22_KI270734v1_random:59472-59494 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1203271882 22_KI270734v1_random:59525-59547 GGAGAGCTCGTGGGGTGCGAGGG No data
1203271868_1203271877 9 Left 1203271868 22_KI270734v1_random:59472-59494 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1203271877 22_KI270734v1_random:59504-59526 CGAGCTGAGCGCGAGAGGGCGGG No data
1203271868_1203271876 8 Left 1203271868 22_KI270734v1_random:59472-59494 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1203271876 22_KI270734v1_random:59503-59525 TCGAGCTGAGCGCGAGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203271868 Original CRISPR CCCCACGCGCCGATTTCCAA GGG (reversed) Intergenic
No off target data available for this crispr