ID: 1203273724

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:74028-74050
Sequence GCTGAGGCCCAGAAATGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203273724_1203273731 30 Left 1203273724 22_KI270734v1_random:74028-74050 CCTTCACATTTCTGGGCCTCAGC No data
Right 1203273731 22_KI270734v1_random:74081-74103 ACCAGAGATCCCAGACCTCCCGG No data
1203273724_1203273725 -8 Left 1203273724 22_KI270734v1_random:74028-74050 CCTTCACATTTCTGGGCCTCAGC No data
Right 1203273725 22_KI270734v1_random:74043-74065 GCCTCAGCCACAGCTGCAGCAGG No data
1203273724_1203273728 2 Left 1203273724 22_KI270734v1_random:74028-74050 CCTTCACATTTCTGGGCCTCAGC No data
Right 1203273728 22_KI270734v1_random:74053-74075 CAGCTGCAGCAGGTGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203273724 Original CRISPR GCTGAGGCCCAGAAATGTGA AGG (reversed) Intergenic
No off target data available for this crispr