ID: 1203273725

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:74043-74065
Sequence GCCTCAGCCACAGCTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203273724_1203273725 -8 Left 1203273724 22_KI270734v1_random:74028-74050 CCTTCACATTTCTGGGCCTCAGC No data
Right 1203273725 22_KI270734v1_random:74043-74065 GCCTCAGCCACAGCTGCAGCAGG No data
1203273723_1203273725 -7 Left 1203273723 22_KI270734v1_random:74027-74049 CCCTTCACATTTCTGGGCCTCAG No data
Right 1203273725 22_KI270734v1_random:74043-74065 GCCTCAGCCACAGCTGCAGCAGG No data
1203273717_1203273725 26 Left 1203273717 22_KI270734v1_random:73994-74016 CCACGTTGGGGTCACTACTGGAG No data
Right 1203273725 22_KI270734v1_random:74043-74065 GCCTCAGCCACAGCTGCAGCAGG No data
1203273716_1203273725 27 Left 1203273716 22_KI270734v1_random:73993-74015 CCCACGTTGGGGTCACTACTGGA No data
Right 1203273725 22_KI270734v1_random:74043-74065 GCCTCAGCCACAGCTGCAGCAGG No data
1203273714_1203273725 28 Left 1203273714 22_KI270734v1_random:73992-74014 CCCCACGTTGGGGTCACTACTGG No data
Right 1203273725 22_KI270734v1_random:74043-74065 GCCTCAGCCACAGCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203273725 Original CRISPR GCCTCAGCCACAGCTGCAGC AGG Intergenic
No off target data available for this crispr