ID: 1203273728

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:74053-74075
Sequence CAGCTGCAGCAGGTGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203273723_1203273728 3 Left 1203273723 22_KI270734v1_random:74027-74049 CCCTTCACATTTCTGGGCCTCAG No data
Right 1203273728 22_KI270734v1_random:74053-74075 CAGCTGCAGCAGGTGCCCAGAGG No data
1203273724_1203273728 2 Left 1203273724 22_KI270734v1_random:74028-74050 CCTTCACATTTCTGGGCCTCAGC No data
Right 1203273728 22_KI270734v1_random:74053-74075 CAGCTGCAGCAGGTGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203273728 Original CRISPR CAGCTGCAGCAGGTGCCCAG AGG Intergenic
No off target data available for this crispr