ID: 1203273731

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:74081-74103
Sequence ACCAGAGATCCCAGACCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203273729_1203273731 -10 Left 1203273729 22_KI270734v1_random:74068-74090 CCCAGAGGTCAGAACCAGAGATC No data
Right 1203273731 22_KI270734v1_random:74081-74103 ACCAGAGATCCCAGACCTCCCGG No data
1203273724_1203273731 30 Left 1203273724 22_KI270734v1_random:74028-74050 CCTTCACATTTCTGGGCCTCAGC No data
Right 1203273731 22_KI270734v1_random:74081-74103 ACCAGAGATCCCAGACCTCCCGG No data
1203273726_1203273731 14 Left 1203273726 22_KI270734v1_random:74044-74066 CCTCAGCCACAGCTGCAGCAGGT No data
Right 1203273731 22_KI270734v1_random:74081-74103 ACCAGAGATCCCAGACCTCCCGG No data
1203273727_1203273731 8 Left 1203273727 22_KI270734v1_random:74050-74072 CCACAGCTGCAGCAGGTGCCCAG No data
Right 1203273731 22_KI270734v1_random:74081-74103 ACCAGAGATCCCAGACCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203273731 Original CRISPR ACCAGAGATCCCAGACCTCC CGG Intergenic
No off target data available for this crispr