ID: 1203277208

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:96746-96768
Sequence TCCCACCCTAGCTGAAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203277201_1203277208 13 Left 1203277201 22_KI270734v1_random:96710-96732 CCAGGATAAGTCATTAGAGAGAG No data
Right 1203277208 22_KI270734v1_random:96746-96768 TCCCACCCTAGCTGAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203277208 Original CRISPR TCCCACCCTAGCTGAAGCCA TGG Intergenic
No off target data available for this crispr