ID: 1203277282

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:97296-97318
Sequence CACCCCAGTGTGCCTGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203277276_1203277282 17 Left 1203277276 22_KI270734v1_random:97256-97278 CCTCTGCATTGCAGTGGATCGTG No data
Right 1203277282 22_KI270734v1_random:97296-97318 CACCCCAGTGTGCCTGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203277282 Original CRISPR CACCCCAGTGTGCCTGGCAT GGG Intergenic
No off target data available for this crispr