ID: 1203281088

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:131370-131392
Sequence CTCATACCTTCCTGCTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203281088_1203281098 23 Left 1203281088 22_KI270734v1_random:131370-131392 CCCGGGGAGCAGGAAGGTATGAG No data
Right 1203281098 22_KI270734v1_random:131416-131438 TGCAGCCACCACGGAGGGACGGG No data
1203281088_1203281099 24 Left 1203281088 22_KI270734v1_random:131370-131392 CCCGGGGAGCAGGAAGGTATGAG No data
Right 1203281099 22_KI270734v1_random:131417-131439 GCAGCCACCACGGAGGGACGGGG No data
1203281088_1203281091 14 Left 1203281088 22_KI270734v1_random:131370-131392 CCCGGGGAGCAGGAAGGTATGAG No data
Right 1203281091 22_KI270734v1_random:131407-131429 AACCCTCCTTGCAGCCACCACGG No data
1203281088_1203281094 17 Left 1203281088 22_KI270734v1_random:131370-131392 CCCGGGGAGCAGGAAGGTATGAG No data
Right 1203281094 22_KI270734v1_random:131410-131432 CCTCCTTGCAGCCACCACGGAGG No data
1203281088_1203281097 22 Left 1203281088 22_KI270734v1_random:131370-131392 CCCGGGGAGCAGGAAGGTATGAG No data
Right 1203281097 22_KI270734v1_random:131415-131437 TTGCAGCCACCACGGAGGGACGG No data
1203281088_1203281095 18 Left 1203281088 22_KI270734v1_random:131370-131392 CCCGGGGAGCAGGAAGGTATGAG No data
Right 1203281095 22_KI270734v1_random:131411-131433 CTCCTTGCAGCCACCACGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203281088 Original CRISPR CTCATACCTTCCTGCTCCCC GGG (reversed) Intergenic
No off target data available for this crispr