ID: 1203281090

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:131393-131415
Sequence AGGAGGGTTTCGCTCAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203281090_1203281102 27 Left 1203281090 22_KI270734v1_random:131393-131415 CCTCAGCTGAGCGAAACCCTCCT No data
Right 1203281102 22_KI270734v1_random:131443-131465 GTCTCCTTCTGAATGACGCAAGG No data
1203281090_1203281103 28 Left 1203281090 22_KI270734v1_random:131393-131415 CCTCAGCTGAGCGAAACCCTCCT No data
Right 1203281103 22_KI270734v1_random:131444-131466 TCTCCTTCTGAATGACGCAAGGG No data
1203281090_1203281091 -9 Left 1203281090 22_KI270734v1_random:131393-131415 CCTCAGCTGAGCGAAACCCTCCT No data
Right 1203281091 22_KI270734v1_random:131407-131429 AACCCTCCTTGCAGCCACCACGG No data
1203281090_1203281099 1 Left 1203281090 22_KI270734v1_random:131393-131415 CCTCAGCTGAGCGAAACCCTCCT No data
Right 1203281099 22_KI270734v1_random:131417-131439 GCAGCCACCACGGAGGGACGGGG No data
1203281090_1203281104 29 Left 1203281090 22_KI270734v1_random:131393-131415 CCTCAGCTGAGCGAAACCCTCCT No data
Right 1203281104 22_KI270734v1_random:131445-131467 CTCCTTCTGAATGACGCAAGGGG No data
1203281090_1203281094 -6 Left 1203281090 22_KI270734v1_random:131393-131415 CCTCAGCTGAGCGAAACCCTCCT No data
Right 1203281094 22_KI270734v1_random:131410-131432 CCTCCTTGCAGCCACCACGGAGG No data
1203281090_1203281097 -1 Left 1203281090 22_KI270734v1_random:131393-131415 CCTCAGCTGAGCGAAACCCTCCT No data
Right 1203281097 22_KI270734v1_random:131415-131437 TTGCAGCCACCACGGAGGGACGG No data
1203281090_1203281095 -5 Left 1203281090 22_KI270734v1_random:131393-131415 CCTCAGCTGAGCGAAACCCTCCT No data
Right 1203281095 22_KI270734v1_random:131411-131433 CTCCTTGCAGCCACCACGGAGGG No data
1203281090_1203281098 0 Left 1203281090 22_KI270734v1_random:131393-131415 CCTCAGCTGAGCGAAACCCTCCT No data
Right 1203281098 22_KI270734v1_random:131416-131438 TGCAGCCACCACGGAGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203281090 Original CRISPR AGGAGGGTTTCGCTCAGCTG AGG (reversed) Intergenic
No off target data available for this crispr