ID: 1203281098

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:131416-131438
Sequence TGCAGCCACCACGGAGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203281088_1203281098 23 Left 1203281088 22_KI270734v1_random:131370-131392 CCCGGGGAGCAGGAAGGTATGAG No data
Right 1203281098 22_KI270734v1_random:131416-131438 TGCAGCCACCACGGAGGGACGGG No data
1203281089_1203281098 22 Left 1203281089 22_KI270734v1_random:131371-131393 CCGGGGAGCAGGAAGGTATGAGC No data
Right 1203281098 22_KI270734v1_random:131416-131438 TGCAGCCACCACGGAGGGACGGG No data
1203281090_1203281098 0 Left 1203281090 22_KI270734v1_random:131393-131415 CCTCAGCTGAGCGAAACCCTCCT No data
Right 1203281098 22_KI270734v1_random:131416-131438 TGCAGCCACCACGGAGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203281098 Original CRISPR TGCAGCCACCACGGAGGGAC GGG Intergenic
No off target data available for this crispr