ID: 1203281180

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:131757-131779
Sequence TACGCGGGCGGGGCGGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 2, 1: 1, 2: 2, 3: 62, 4: 543}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203281165_1203281180 23 Left 1203281165 22_KI270734v1_random:131711-131733 CCAGCTGCTGTCGGCGTTACAGA No data
Right 1203281180 22_KI270734v1_random:131757-131779 TACGCGGGCGGGGCGGGCGGCGG 0: 2
1: 1
2: 2
3: 62
4: 543
1203281169_1203281180 -1 Left 1203281169 22_KI270734v1_random:131735-131757 CCTGGTGAAGGAGTTGCCCAGGT No data
Right 1203281180 22_KI270734v1_random:131757-131779 TACGCGGGCGGGGCGGGCGGCGG 0: 2
1: 1
2: 2
3: 62
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203281180 Original CRISPR TACGCGGGCGGGGCGGGCGG CGG Intergenic