ID: 1203281567

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:134464-134486
Sequence CTGCAGGCACAGCTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203281558_1203281567 27 Left 1203281558 22_KI270734v1_random:134414-134436 CCATCGTCGAGGTGTGTACAGAA 0: 3
1: 0
2: 1
3: 0
4: 40
Right 1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG No data
1203281563_1203281567 2 Left 1203281563 22_KI270734v1_random:134439-134461 CCAAGAAACAGGAGATTGGGGAA 0: 2
1: 0
2: 2
3: 28
4: 287
Right 1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203281567 Original CRISPR CTGCAGGCACAGCTGGAGCC AGG Intergenic
No off target data available for this crispr