ID: 1203284159

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:146390-146412
Sequence CACCACAAGGAGAGGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203284159_1203284166 -5 Left 1203284159 22_KI270734v1_random:146390-146412 CCAGACCCCCTCTCCTTGTGGTG No data
Right 1203284166 22_KI270734v1_random:146408-146430 TGGTGTCTTAAGGCTCCGCGTGG No data
1203284159_1203284167 -4 Left 1203284159 22_KI270734v1_random:146390-146412 CCAGACCCCCTCTCCTTGTGGTG No data
Right 1203284167 22_KI270734v1_random:146409-146431 GGTGTCTTAAGGCTCCGCGTGGG No data
1203284159_1203284169 22 Left 1203284159 22_KI270734v1_random:146390-146412 CCAGACCCCCTCTCCTTGTGGTG No data
Right 1203284169 22_KI270734v1_random:146435-146457 CTGTCCCGCCAAGCACTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203284159 Original CRISPR CACCACAAGGAGAGGGGGTC TGG (reversed) Intergenic
No off target data available for this crispr