ID: 1203285728

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:153536-153558
Sequence GCCCTGGGCCTGATGAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203285728_1203285736 12 Left 1203285728 22_KI270734v1_random:153536-153558 CCACCCCTCATCAGGCCCAGGGC No data
Right 1203285736 22_KI270734v1_random:153571-153593 AGGGCACATGATCGCACACATGG 0: 2
1: 0
2: 0
3: 7
4: 101
1203285728_1203285738 23 Left 1203285728 22_KI270734v1_random:153536-153558 CCACCCCTCATCAGGCCCAGGGC No data
Right 1203285738 22_KI270734v1_random:153582-153604 TCGCACACATGGGCACGACCTGG 0: 2
1: 0
2: 0
3: 3
4: 33
1203285728_1203285733 -8 Left 1203285728 22_KI270734v1_random:153536-153558 CCACCCCTCATCAGGCCCAGGGC No data
Right 1203285733 22_KI270734v1_random:153551-153573 CCCAGGGCATAGTCTGTTGAAGG 0: 2
1: 0
2: 0
3: 10
4: 172
1203285728_1203285735 -7 Left 1203285728 22_KI270734v1_random:153536-153558 CCACCCCTCATCAGGCCCAGGGC No data
Right 1203285735 22_KI270734v1_random:153552-153574 CCAGGGCATAGTCTGTTGAAGGG No data
1203285728_1203285737 13 Left 1203285728 22_KI270734v1_random:153536-153558 CCACCCCTCATCAGGCCCAGGGC No data
Right 1203285737 22_KI270734v1_random:153572-153594 GGGCACATGATCGCACACATGGG 0: 2
1: 0
2: 0
3: 8
4: 68
1203285728_1203285739 24 Left 1203285728 22_KI270734v1_random:153536-153558 CCACCCCTCATCAGGCCCAGGGC No data
Right 1203285739 22_KI270734v1_random:153583-153605 CGCACACATGGGCACGACCTGGG 0: 2
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203285728 Original CRISPR GCCCTGGGCCTGATGAGGGG TGG (reversed) Intergenic
No off target data available for this crispr