ID: 1203285827

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:153938-153960
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 2, 1: 0, 2: 0, 3: 22, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203285827_1203285840 19 Left 1203285827 22_KI270734v1_random:153938-153960 CCTGCACAGCCAGACCAATGCCC 0: 2
1: 0
2: 0
3: 22
4: 228
Right 1203285840 22_KI270734v1_random:153980-154002 TCCCTCACAGCCCAATCATCAGG 0: 2
1: 0
2: 2
3: 7
4: 134
1203285827_1203285830 -7 Left 1203285827 22_KI270734v1_random:153938-153960 CCTGCACAGCCAGACCAATGCCC 0: 2
1: 0
2: 0
3: 22
4: 228
Right 1203285830 22_KI270734v1_random:153954-153976 AATGCCCCCATCCACCCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203285827 Original CRISPR GGGCATTGGTCTGGCTGTGC AGG (reversed) Intergenic
900161064 1:1224018-1224040 CGGCATCCGTCTGGCTGTTCGGG - Intronic
900937624 1:5776535-5776557 GCCCCTTGGTCTGGCTGTGATGG + Intergenic
902399816 1:16151724-16151746 GGGCAGTGGTCAGGATGTGAGGG - Intronic
903396631 1:23006586-23006608 GGGCATTGCTCTGGGTTTGGGGG - Intergenic
904626249 1:31805537-31805559 GGGCCAGGGTCTGGCTGTGTTGG - Intronic
905857286 1:41322384-41322406 GGGCCTGGGTCTGGGTGTGATGG + Intergenic
905901037 1:41582115-41582137 GGGCAAGTGTCTGGCTGCGCTGG + Exonic
906102686 1:43273172-43273194 GGGCATTGCTCTGGCTGCCTTGG + Exonic
906258591 1:44368963-44368985 CTGCAGTGGTCTGGCTGTGTAGG + Intergenic
909541134 1:76792762-76792784 GGGCAAGGGCCAGGCTGTGCAGG - Intergenic
918047355 1:180949498-180949520 GGGGCTTGGGCTGGCTGGGCTGG - Exonic
918520083 1:185405989-185406011 AGGCATGGGTCTGTCTGAGCTGG + Intergenic
920434199 1:205937735-205937757 CTGCATGGGTCTGGCTGTCCAGG + Intronic
920807690 1:209250624-209250646 GGTCATTGGTATTGCTGTTCTGG - Intergenic
922473488 1:225890619-225890641 GGGCAGTGGTCTGGCCATACTGG + Intronic
922661098 1:227430921-227430943 AGCCAGTGGTCTTGCTGTGCTGG - Intergenic
923009525 1:230077117-230077139 GGGCATTTGTATGGCTGTCCTGG + Intronic
923018956 1:230148210-230148232 GGCCACTGATCTGGTTGTGCCGG - Intronic
923497951 1:234541164-234541186 GGGCATTGCCCGGGCTGTGTGGG + Intergenic
1065902074 10:30217220-30217242 GGCCATTGGCCTGGCTCTCCTGG + Intergenic
1067165618 10:43864368-43864390 GGGCTGTGCTGTGGCTGTGCTGG + Intergenic
1069755816 10:70774011-70774033 GGGGGCTGGTCTGGCTGTGTTGG + Intronic
1070840980 10:79487727-79487749 CGCCCATGGTCTGGCTGTGCAGG + Intergenic
1071148651 10:82606641-82606663 AGGCATTGGACAGGGTGTGCTGG + Intronic
1072710253 10:97711855-97711877 GGCCTTTGGCCTGGCTGAGCAGG - Intergenic
1075045493 10:119143170-119143192 GCTCCTTGGCCTGGCTGTGCAGG + Intronic
1075655050 10:124155859-124155881 GGGCAGTGGCCTGGCTGCTCGGG - Intergenic
1076670115 10:132115926-132115948 GGGCATTGGGCCGGATGTGCTGG + Intronic
1076691175 10:132224565-132224587 TGGCATTGTTCTGGGTGTCCTGG - Intronic
1076697004 10:132251773-132251795 GGGCATTGACCTGCCTGTGGTGG - Intronic
1076697020 10:132251828-132251850 GGGCATTGACCTGCCTGTGGTGG - Intronic
1076697050 10:132251938-132251960 GGGCATTGACCTGCCTGTGGTGG - Intronic
1077043409 11:534390-534412 GGGCCTGGGCCTGGCTGAGCAGG - Intronic
1077095058 11:795726-795748 GGGCAAGGGGCTGGCTGTGGGGG - Intronic
1077296295 11:1827797-1827819 GGGCATGTCGCTGGCTGTGCAGG + Intergenic
1077385777 11:2268966-2268988 CGGCATTGGTCAGGCTGGGCCGG + Exonic
1078088909 11:8251689-8251711 GTGCATGTGTCTGCCTGTGCAGG + Intronic
1080572394 11:33568107-33568129 GGGCAAAGCTCTGGTTGTGCAGG - Exonic
1081188416 11:40073733-40073755 GGGGATTGGTCAGGCAGTGATGG - Intergenic
1081664418 11:44908249-44908271 GGGCTTTGGCTTGGCTGAGCAGG - Intronic
1081978176 11:47248963-47248985 GGGTCGTGGTCTGGCTGTGGCGG + Intronic
1083040457 11:59680532-59680554 GGGGATTGTCCTGCCTGTGCAGG + Intergenic
1085259072 11:75193937-75193959 GGCCATTCCTCTGGCTGAGCTGG - Intronic
1085399297 11:76225994-76226016 GGCCTTTGGGCTGGGTGTGCAGG - Intergenic
1085426884 11:76412653-76412675 GGGCTTGGGTTTGGCTTTGCTGG - Intronic
1085523877 11:77153361-77153383 GAGCTCTGGTCTGGATGTGCTGG + Intronic
1085535188 11:77213314-77213336 GGTCATGGGGCTGGCTGTGCAGG + Intronic
1087153556 11:94879931-94879953 GGGCAGGGGTCAGACTGTGCAGG - Intergenic
1090255211 11:125279050-125279072 GGGCATGTGTCTGGCTTGGCGGG + Intronic
1090703525 11:129316478-129316500 GGCCATGGCTCAGGCTGTGCAGG - Intergenic
1090888140 11:130897562-130897584 TGGCATTGCTCTGGGTGTCCAGG + Intronic
1091300137 11:134502360-134502382 GGGCATAGATCTGGCTCTGGGGG + Intergenic
1095307440 12:40654527-40654549 AAGCATTGGTCTGTCTGTGATGG - Intergenic
1096075047 12:48798437-48798459 TGGCATTTGTCTTTCTGTGCTGG + Intergenic
1096115130 12:49051059-49051081 GGGCATTGGCCTGGCTCCTCAGG + Exonic
1096199032 12:49668185-49668207 GGGTATAGGATTGGCTGTGCAGG - Intronic
1099202577 12:79692240-79692262 GGTCTTTGGTCTGGCTGTTGTGG + Intergenic
1100435944 12:94571823-94571845 GGGCATTGGGCTTTCTGAGCTGG - Intronic
1101326979 12:103724196-103724218 TGGCAATGTCCTGGCTGTGCTGG - Intronic
1102956730 12:117063716-117063738 GGGCACTGGGCAGGCAGTGCAGG - Intronic
1103178737 12:118889194-118889216 AGGCATTGGTATAGCTGTGCTGG + Intergenic
1103602542 12:122063463-122063485 CGGCATTGGTTGAGCTGTGCTGG + Intergenic
1103630215 12:122253965-122253987 GGGTATTGGGCTGGGTGTGGTGG - Intronic
1108229082 13:48318757-48318779 GGCCACTGGTCTGGCTGTTGGGG + Intronic
1109024617 13:57142449-57142471 GCGGGTTGGGCTGGCTGTGCGGG - Exonic
1109025604 13:57149019-57149041 GCGGGTTGGGCTGGCTGTGCGGG - Exonic
1109026594 13:57155592-57155614 GCGGGTTGGGCTGGCTGTGCGGG - Exonic
1109027586 13:57162163-57162185 GCGGGTTGGGCTGGCTGTGCGGG - Exonic
1109028572 13:57168728-57168750 GCGGGTTGGGCTGGCTGTGCGGG - Exonic
1111041272 13:82751766-82751788 GGACATGGGTCTTTCTGTGCGGG + Intergenic
1113393345 13:109918962-109918984 GGGCATTGGTGTTGCTCTGATGG + Intergenic
1113577118 13:111402673-111402695 CGGCATTGCTATGCCTGTGCTGG + Intergenic
1113582931 13:111441332-111441354 GGGCATGTGTGTGGATGTGCTGG - Intergenic
1113878350 13:113608411-113608433 GGGCAGAGCCCTGGCTGTGCAGG + Intronic
1114660404 14:24339913-24339935 GGGAAGGGGTCTGTCTGTGCAGG + Exonic
1118292035 14:64535770-64535792 AGGGTTTGGTGTGGCTGTGCGGG + Intergenic
1118785098 14:69038984-69039006 GGGCATTGCCCTGGCTGTGGTGG + Intergenic
1121683735 14:95816289-95816311 AGGCATTGCTGTGGCTGAGCTGG + Intergenic
1122008569 14:98726944-98726966 GGGCATTGGTCTGGAGCTGAAGG + Intergenic
1122740888 14:103871123-103871145 TGGCATTGCTCTGGCTGTCCTGG + Intergenic
1123039748 14:105485656-105485678 TGGCCTTGGGCTGGGTGTGCTGG + Intergenic
1123060446 14:105592001-105592023 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123065412 14:105616630-105616652 GGGCACAGGCGTGGCTGTGCCGG + Intergenic
1123084924 14:105712972-105712994 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123088708 14:105731879-105731901 GGGCACAGGCGTGGCTGTGCCGG + Intergenic
1124498875 15:30209118-30209140 GGGCACTGGGCTGGATGTGGTGG + Intergenic
1124744703 15:32329558-32329580 GGGCACTGGGCTGGGTGTGGTGG - Intergenic
1130574014 15:85074412-85074434 GGGCATTTGGCTGAGTGTGCTGG + Intronic
1132516110 16:366766-366788 AGGCTGTGGTCTGGCTCTGCAGG - Intergenic
1132723323 16:1327514-1327536 GGACCTGGGTCTGGCTGGGCCGG + Intergenic
1133031502 16:3013389-3013411 GGGCATGACCCTGGCTGTGCTGG + Exonic
1135057388 16:19241907-19241929 TGCCATTGCTCTGGCTGTGGTGG - Intronic
1135277517 16:21126462-21126484 GGGAATTTCTCTGGCTGTGGAGG + Intronic
1135288802 16:21217008-21217030 GGGCTTTGGTCTTGTTGCGCAGG + Intergenic
1135977839 16:27122559-27122581 CCGCTTTGTTCTGGCTGTGCTGG + Intergenic
1136040554 16:27575558-27575580 GGGCATTTGTCAGGCTCAGCTGG + Intronic
1137321613 16:47389087-47389109 GGACATATGTCTGGCTGAGCCGG + Intronic
1138339902 16:56281738-56281760 GGGCCTTGTTCTGGCTGAGCTGG + Intronic
1139424059 16:66868063-66868085 GGGCCTGAGCCTGGCTGTGCTGG + Intronic
1140332391 16:74070551-74070573 GGCCTTTGGCCTGGCTGTGATGG - Intergenic
1140581391 16:76235126-76235148 AGGGTTTGGTGTGGCTGTGCGGG + Intergenic
1141040646 16:80669902-80669924 GAGCATGTGTCTGGCTGGGCAGG - Intronic
1141936003 16:87238193-87238215 TGGCATGGGTGTGGCTCTGCTGG - Intronic
1142412662 16:89924233-89924255 GGGCGTTGGTGCAGCTGTGCAGG + Intronic
1142850770 17:2703750-2703772 GGGCATTGCTCTGGGTCTGCAGG - Intronic
1144209721 17:13003876-13003898 GAGCCTGGGTCTGGCTTTGCAGG - Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1145960543 17:28884337-28884359 GGGCATGGGTCTGGGGGCGCAGG + Intronic
1148019622 17:44544862-44544884 GGGAATTGGGCTCGCTGTCCAGG + Intergenic
1150128239 17:62652640-62652662 GGGCATTTGTCTAGCTGGGCGGG + Intronic
1151668456 17:75558659-75558681 GGGCAAGGGTCAGGCTGGGCTGG - Intronic
1151701239 17:75743677-75743699 GGGCATTTGTCAGAGTGTGCTGG - Intronic
1152486342 17:80596478-80596500 GGGCATAGGTTGGGGTGTGCAGG + Intronic
1152558369 17:81065844-81065866 GCCCTTTGGCCTGGCTGTGCAGG + Intronic
1152889737 17:82873706-82873728 TGGCCTTGGTCTGGGTGTGGAGG + Intronic
1154251088 18:12745995-12746017 AGGCATTAGGCTGGCTGTGATGG + Intergenic
1156549567 18:38001174-38001196 GGGCATTGGGCTGACAGTTCTGG - Intergenic
1157733849 18:50029231-50029253 GTGCACTGGCATGGCTGTGCAGG + Intronic
1158950584 18:62491188-62491210 GTGCTTTGTTCTAGCTGTGCTGG - Intergenic
1158982886 18:62782217-62782239 AGGCATGAGTCTGCCTGTGCAGG + Intronic
1159816988 18:73086392-73086414 GGGCAGGGTTCTGGCTTTGCTGG + Intergenic
1160806285 19:993601-993623 GGGCAGTGGCCTTGCTGGGCCGG + Intronic
1160894791 19:1397327-1397349 GGGCATGGGTGTGGCCGGGCCGG + Intronic
1162068878 19:8141981-8142003 CGGCAGGGGTGTGGCTGTGCAGG + Exonic
1162300436 19:9841973-9841995 GGGCATGGGTCTGGGTGTGGTGG + Intronic
1162926195 19:13931635-13931657 GGCCCTTGGTCTGGCTCTCCTGG - Intronic
1162964464 19:14149380-14149402 GGGCATGGGTATGGCTGAGGAGG - Exonic
1162967208 19:14161574-14161596 GGGCGTGGGCCTGGCTGTGGTGG + Exonic
1163084749 19:14971393-14971415 GGGCTATGGTATGGATGTGCAGG - Intronic
1163541263 19:17912170-17912192 GGGCATGGGGCTGGGTGTGGTGG - Intergenic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1163728961 19:18938977-18938999 GGACATTGGTCAGGCTGGGATGG + Exonic
1163761628 19:19140096-19140118 TGGCCCTGGTCTGGATGTGCGGG + Intergenic
1165337635 19:35182869-35182891 AGGCAGTGGTGTGGCTTTGCTGG - Intergenic
1165502722 19:36202933-36202955 GGGCAGTACTCTGGATGTGCGGG - Intronic
1165846418 19:38820787-38820809 GGGCTTTTTTGTGGCTGTGCCGG - Intronic
1167159032 19:47755689-47755711 GGGCTTTGGACTGGGTGTCCTGG + Intronic
1167580006 19:50335731-50335753 GGGCATTGGACTGTGTGTGATGG + Intronic
925959524 2:9003051-9003073 ATGCATGGGTCTGGGTGTGCTGG - Intronic
926724155 2:15984475-15984497 GGGCCTTGGCTGGGCTGTGCGGG + Intergenic
927473831 2:23397044-23397066 GGGTAGAGGTCTGGCAGTGCGGG + Intronic
928130101 2:28642985-28643007 GGACAGTGGTCTGGAGGTGCAGG + Exonic
928374054 2:30760773-30760795 GGGCCTTGGTCTGGGGGAGCAGG + Intronic
928949757 2:36804303-36804325 GGGCACAGGTCTGGTTGGGCAGG - Intronic
929410955 2:41696996-41697018 GGGAATAGGTCTTGCTATGCTGG - Intergenic
930711050 2:54551424-54551446 GGGCATTCTTTTGTCTGTGCAGG + Intronic
934856987 2:97735589-97735611 GGGTATGGGTGTGGGTGTGCAGG - Intronic
935815911 2:106845520-106845542 TGGCATTGGTCAGCCTGTACTGG - Intronic
937630733 2:124098337-124098359 GGGAATTGGTCTTGATATGCAGG + Intronic
940218815 2:151329169-151329191 GGTCAGTTGCCTGGCTGTGCAGG - Intergenic
944100369 2:196019910-196019932 GGAGATTGGTCTTGCTGTGCGGG - Intronic
946964886 2:225027210-225027232 GGGGCCTGGTCTGGGTGTGCAGG - Intronic
947010254 2:225558084-225558106 AGGGAGTGGTCTGGCTGTGGAGG + Intronic
947564731 2:231186419-231186441 GTGCAGTGTTCAGGCTGTGCAGG + Intergenic
948051309 2:234981443-234981465 GTGCACTGGCCTGGCTGTGAGGG - Intronic
948100085 2:235366311-235366333 GGGAATTGGTCAGGCTGCCCTGG + Intergenic
948602693 2:239116298-239116320 CGGCATTGGACCTGCTGTGCTGG - Intronic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1169761086 20:9095052-9095074 GGGCATTGGTGTTGCTCTGAAGG + Intronic
1170893177 20:20392922-20392944 GGGCACTGGTGTGGCTGCTCTGG - Exonic
1171429395 20:25071523-25071545 GGGCATTGTTCTGACTTTTCTGG - Intronic
1172325167 20:34028991-34029013 GACCATTAGTCTGGCTGTGTGGG + Intronic
1173523161 20:43713759-43713781 GGCCAGTGGACTTGCTGTGCCGG + Intronic
1173808418 20:45941065-45941087 CAGCATTGGTCTGGATGTCCAGG - Exonic
1174048208 20:47748606-47748628 GGGCACTGGCCTGGAGGTGCTGG + Intronic
1175563431 20:59953182-59953204 GGACAGTGGTCTGGCTGGTCAGG + Intergenic
1175563706 20:59955156-59955178 GGACAGTGGTCTGGCTGGCCAGG - Intergenic
1175675772 20:60945601-60945623 GGGCAGTGGCCTGGGTCTGCAGG - Intergenic
1175936850 20:62517979-62518001 GGGCATGGGGGAGGCTGTGCGGG - Intergenic
1176426395 21:6551154-6551176 GGGCATTGTTGTGGCTCAGCGGG - Intergenic
1179701886 21:43159471-43159493 GGGCATTGTTGTGGCTCAGCGGG - Exonic
1180835738 22:18928639-18928661 GGGCATTGGTCTGGCTGTGCAGG - Intronic
1181085440 22:20437515-20437537 GGGCAGTGGTGTGGCGGCGCCGG - Intronic
1181270923 22:21658020-21658042 GGGCATGGGACCGGCTGGGCGGG + Intronic
1181442563 22:22944358-22944380 GTGCATTAGTCTGGCTGCTCTGG - Intergenic
1181597779 22:23928355-23928377 TGGCCTTGGTGTGGCTGTACTGG + Intergenic
1182062251 22:27406698-27406720 AGGCCTAGGTCTGGCTATGCTGG - Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183383103 22:37500331-37500353 GGGCAGTGGTGAGGCTATGCTGG + Intronic
1183649564 22:39146009-39146031 GGGGGTTGGCCTGGCTCTGCGGG - Intronic
1184057199 22:42060502-42060524 GGACTTTGGCCTGTCTGTGCTGG + Intronic
1185425781 22:50769569-50769591 GGACATTGGTCTGTCTGTCAAGG + Intronic
1203285827 22_KI270734v1_random:153938-153960 GGGCATTGGTCTGGCTGTGCAGG - Intergenic
949920607 3:8997263-8997285 GGGCATTGGCCTGGGTGAGCAGG - Intronic
950127326 3:10517943-10517965 GGGGATTGGGCAGCCTGTGCAGG + Intronic
950716459 3:14850906-14850928 GGGAGTTGGTTTGGCTGTGTAGG + Intronic
954200997 3:49022949-49022971 GGGCATTGCTGTGGAAGTGCAGG + Exonic
954670838 3:52290594-52290616 GGGCTTTGGCAAGGCTGTGCTGG + Exonic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
961716123 3:128858642-128858664 GGGAATTGGTCTGGATGCCCTGG + Intergenic
963946091 3:151146895-151146917 GGCCAGTGGTCTGACTCTGCTGG + Intronic
964050802 3:152390875-152390897 GGGCATTGTTCTGGTTAAGCTGG - Intronic
967145785 3:186604778-186604800 GGGCAGTTTTCTGTCTGTGCTGG - Intergenic
967319798 3:188184199-188184221 GGGCATTGGTGAGGCTCTGAAGG + Intronic
968863077 4:3188144-3188166 GGGCAGTGGGGTGGCTGTCCTGG + Intronic
969093193 4:4712186-4712208 GGGCATTGGCCTCTCTGTGCTGG - Intergenic
971147493 4:23994751-23994773 GGAAATTGGTCAGGCTTTGCAGG + Intergenic
971424611 4:26503462-26503484 GGGCACTGGGCTGGCTGAGCTGG - Intergenic
973818287 4:54639350-54639372 AGGCATTGATGAGGCTGTGCTGG - Intergenic
982594559 4:157362858-157362880 GGGCCTTGGTTTGGCAATGCTGG + Exonic
984050342 4:174857566-174857588 GGGCATTGGTTTGTCTGTTAAGG + Intronic
984305931 4:177990571-177990593 GGGGATTGCTATGGCTCTGCCGG + Exonic
985915006 5:2910877-2910899 GGGAATGGGTCTGCCTGTGAGGG - Intergenic
985940543 5:3132307-3132329 GCTCATTGGTCTGACTCTGCCGG - Intergenic
994682206 5:102902319-102902341 GCACATTGCTCTGGCTTTGCAGG - Intronic
996271977 5:121616721-121616743 AGGGTTTGGTGTGGCTGTGCCGG - Intergenic
996503072 5:124238199-124238221 GAGCAGTGGTCTGGGTGTGGTGG + Intergenic
997836958 5:137202413-137202435 GGGCATTAGTCTGGCTTTTCTGG - Intronic
999148230 5:149409789-149409811 GGGCTGTGGTGTGGCTGTGAGGG - Intergenic
1002893469 6:1357729-1357751 AGGGATTGGTCTTGCTGTCCTGG - Intergenic
1004445935 6:15698533-15698555 GGGCATTGGTCTCTCTCTCCAGG + Intergenic
1006268942 6:32949325-32949347 GGCCTTTGGCCTGGGTGTGCTGG - Exonic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1006835777 6:36998072-36998094 GGGCAGCGGGCTGGCTGTGCAGG + Intergenic
1007621295 6:43216411-43216433 GGGCAGTGGTCAGGCCGTACGGG - Exonic
1008489790 6:52074626-52074648 GGCCATTTGTCAGCCTGTGCTGG - Intronic
1010055557 6:71560134-71560156 TGGCAGTGGTATGGCTTTGCTGG + Intergenic
1010259178 6:73795715-73795737 GGGCATAGCACTGGCTGTGGAGG + Intronic
1016101911 6:140113497-140113519 GGTCATTGGTGTGGTGGTGCTGG - Intergenic
1018002248 6:159589629-159589651 GGTGACTTGTCTGGCTGTGCGGG - Intergenic
1019144845 6:169969980-169970002 GGGCTGTGGCCTGGCTGTGCTGG + Intergenic
1019148987 6:169992039-169992061 GGGCCTTGGTGTGTCTGTGAGGG + Intergenic
1020255764 7:6502500-6502522 GGGGATTGGGCTGGGTGTGGTGG - Intronic
1027257732 7:76441951-76441973 GGGCGTAGGCCTGGCTGTGGTGG + Exonic
1027281116 7:76610084-76610106 GGGCGTAGGCCTGGCTGTGGTGG - Exonic
1029437491 7:100571306-100571328 GGGCTCTGGCCTGGCGGTGCCGG - Intergenic
1030839542 7:114331523-114331545 GGTCATTGGATTGGCTGTGGAGG + Intronic
1032091605 7:128914260-128914282 GGGCACTGGCCTAGCTGTGCTGG + Intergenic
1032165442 7:129541357-129541379 GGGCTGTGGCCTGGCTGTGATGG + Intergenic
1033109919 7:138564647-138564669 GGGAATTGGTCTGGGTGCCCTGG + Intronic
1035242619 7:157542136-157542158 GGGCTCAGGTCGGGCTGTGCCGG + Intronic
1036184498 8:6612329-6612351 GGGAAGTGGGCTGGCTGTGGAGG - Intronic
1036825294 8:11971114-11971136 GGTCATTGGTCTGGAAGTGAGGG - Intergenic
1038446679 8:27609317-27609339 GGGCATAACTCTGGGTGTGCCGG - Intronic
1038679178 8:29651201-29651223 GAGCTTGGGGCTGGCTGTGCAGG + Intergenic
1042821814 8:72937547-72937569 TGGCAGTGGCCTGGCTGTGCTGG - Exonic
1042880356 8:73481275-73481297 TGGCTTTGCGCTGGCTGTGCAGG - Intronic
1044206095 8:89493470-89493492 GGGTATTAACCTGGCTGTGCAGG - Intergenic
1045291161 8:100834010-100834032 CTGCTTTGTTCTGGCTGTGCTGG + Intergenic
1046654237 8:116874864-116874886 GGGGCTTGGGCTGGCTGCGCAGG - Exonic
1047861635 8:128973370-128973392 AGGCATTGTTCTGGCTGCACTGG + Intergenic
1048880620 8:138869536-138869558 AGGCTTAGGTCTGGCTGGGCAGG + Intronic
1049173641 8:141177659-141177681 GGGCTTTGGTTTGACTATGCTGG - Intronic
1049577816 8:143397786-143397808 GGGCATCCTTCTGGCTGGGCAGG + Intergenic
1049662303 8:143824900-143824922 GGGCAGGGGTCTGGATGCGCAGG + Intronic
1053279109 9:36805937-36805959 GGGCATTTGTCTGGCTCCCCTGG + Intergenic
1053345405 9:37374531-37374553 TGCCATTGGTCTGGGGGTGCAGG - Intergenic
1055414626 9:76067953-76067975 AGGCATGGGACTCGCTGTGCTGG + Exonic
1062282725 9:135759205-135759227 GGGCGCTTGTCTGGCTGTGCCGG + Intronic
1185724019 X:2404977-2404999 GGGCTTGGCTCTGGCTGAGCGGG + Intronic
1195087055 X:101422658-101422680 GGGGACTAGTCTGCCTGTGCAGG - Intronic
1198504208 X:137285262-137285284 GGGCAGGAGTCAGGCTGTGCAGG + Intergenic