ID: 1203287326

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:161313-161335
Sequence GCTGCTGGCGCGCCACGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203287326_1203287332 10 Left 1203287326 22_KI270734v1_random:161313-161335 CCTGCTCGTGGCGCGCCAGCAGC No data
Right 1203287332 22_KI270734v1_random:161346-161368 CGCACAAGCGCAGCACCAGCAGG No data
1203287326_1203287334 29 Left 1203287326 22_KI270734v1_random:161313-161335 CCTGCTCGTGGCGCGCCAGCAGC No data
Right 1203287334 22_KI270734v1_random:161365-161387 CAGGCTCCGCGCCAGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203287326 Original CRISPR GCTGCTGGCGCGCCACGAGC AGG (reversed) Intergenic
No off target data available for this crispr