ID: 1203287332

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:161346-161368
Sequence CGCACAAGCGCAGCACCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203287321_1203287332 25 Left 1203287321 22_KI270734v1_random:161298-161320 CCTGCACCCCGCGCACCTGCTCG No data
Right 1203287332 22_KI270734v1_random:161346-161368 CGCACAAGCGCAGCACCAGCAGG No data
1203287324_1203287332 18 Left 1203287324 22_KI270734v1_random:161305-161327 CCCGCGCACCTGCTCGTGGCGCG No data
Right 1203287332 22_KI270734v1_random:161346-161368 CGCACAAGCGCAGCACCAGCAGG No data
1203287325_1203287332 17 Left 1203287325 22_KI270734v1_random:161306-161328 CCGCGCACCTGCTCGTGGCGCGC No data
Right 1203287332 22_KI270734v1_random:161346-161368 CGCACAAGCGCAGCACCAGCAGG No data
1203287330_1203287332 -5 Left 1203287330 22_KI270734v1_random:161328-161350 CCAGCAGCGCGGGCCAGGCGCAC No data
Right 1203287332 22_KI270734v1_random:161346-161368 CGCACAAGCGCAGCACCAGCAGG No data
1203287318_1203287332 30 Left 1203287318 22_KI270734v1_random:161293-161315 CCCCGCCTGCACCCCGCGCACCT No data
Right 1203287332 22_KI270734v1_random:161346-161368 CGCACAAGCGCAGCACCAGCAGG No data
1203287320_1203287332 28 Left 1203287320 22_KI270734v1_random:161295-161317 CCGCCTGCACCCCGCGCACCTGC No data
Right 1203287332 22_KI270734v1_random:161346-161368 CGCACAAGCGCAGCACCAGCAGG No data
1203287323_1203287332 19 Left 1203287323 22_KI270734v1_random:161304-161326 CCCCGCGCACCTGCTCGTGGCGC No data
Right 1203287332 22_KI270734v1_random:161346-161368 CGCACAAGCGCAGCACCAGCAGG No data
1203287319_1203287332 29 Left 1203287319 22_KI270734v1_random:161294-161316 CCCGCCTGCACCCCGCGCACCTG No data
Right 1203287332 22_KI270734v1_random:161346-161368 CGCACAAGCGCAGCACCAGCAGG No data
1203287326_1203287332 10 Left 1203287326 22_KI270734v1_random:161313-161335 CCTGCTCGTGGCGCGCCAGCAGC No data
Right 1203287332 22_KI270734v1_random:161346-161368 CGCACAAGCGCAGCACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203287332 Original CRISPR CGCACAAGCGCAGCACCAGC AGG Intergenic
No off target data available for this crispr