ID: 1203287334 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22_KI270734v1_random:161365-161387 |
| Sequence | CAGGCTCCGCGCCAGCTCCC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1203287331_1203287334 | 1 | Left | 1203287331 | 22_KI270734v1_random:161341-161363 | CCAGGCGCACAAGCGCAGCACCA | No data | ||
| Right | 1203287334 | 22_KI270734v1_random:161365-161387 | CAGGCTCCGCGCCAGCTCCCAGG | No data | ||||
| 1203287326_1203287334 | 29 | Left | 1203287326 | 22_KI270734v1_random:161313-161335 | CCTGCTCGTGGCGCGCCAGCAGC | No data | ||
| Right | 1203287334 | 22_KI270734v1_random:161365-161387 | CAGGCTCCGCGCCAGCTCCCAGG | No data | ||||
| 1203287330_1203287334 | 14 | Left | 1203287330 | 22_KI270734v1_random:161328-161350 | CCAGCAGCGCGGGCCAGGCGCAC | No data | ||
| Right | 1203287334 | 22_KI270734v1_random:161365-161387 | CAGGCTCCGCGCCAGCTCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1203287334 | Original CRISPR | CAGGCTCCGCGCCAGCTCCC AGG | Intergenic | ||
| No off target data available for this crispr | |||||