ID: 1203287334

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270734v1_random:161365-161387
Sequence CAGGCTCCGCGCCAGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203287331_1203287334 1 Left 1203287331 22_KI270734v1_random:161341-161363 CCAGGCGCACAAGCGCAGCACCA No data
Right 1203287334 22_KI270734v1_random:161365-161387 CAGGCTCCGCGCCAGCTCCCAGG No data
1203287326_1203287334 29 Left 1203287326 22_KI270734v1_random:161313-161335 CCTGCTCGTGGCGCGCCAGCAGC No data
Right 1203287334 22_KI270734v1_random:161365-161387 CAGGCTCCGCGCCAGCTCCCAGG No data
1203287330_1203287334 14 Left 1203287330 22_KI270734v1_random:161328-161350 CCAGCAGCGCGGGCCAGGCGCAC No data
Right 1203287334 22_KI270734v1_random:161365-161387 CAGGCTCCGCGCCAGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203287334 Original CRISPR CAGGCTCCGCGCCAGCTCCC AGG Intergenic
No off target data available for this crispr