ID: 1203289108

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270735v1_random:17231-17253
Sequence AAGAAGGAGGGCGGTGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203289108_1203289123 26 Left 1203289108 22_KI270735v1_random:17231-17253 CCCCCGCCACCGCCCTCCTTCTT No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289108_1203289117 3 Left 1203289108 22_KI270735v1_random:17231-17253 CCCCCGCCACCGCCCTCCTTCTT No data
Right 1203289117 22_KI270735v1_random:17257-17279 TCCCATCGCCGCCACGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203289108 Original CRISPR AAGAAGGAGGGCGGTGGCGG GGG (reversed) Intergenic