ID: 1203289108 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22_KI270735v1_random:17231-17253 |
| Sequence | AAGAAGGAGGGCGGTGGCGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1203289108_1203289123 | 26 | Left | 1203289108 | 22_KI270735v1_random:17231-17253 | CCCCCGCCACCGCCCTCCTTCTT | No data | ||
| Right | 1203289123 | 22_KI270735v1_random:17280-17302 | CCGCTCTATGCAAGACTCAGCGG | No data | ||||
| 1203289108_1203289117 | 3 | Left | 1203289108 | 22_KI270735v1_random:17231-17253 | CCCCCGCCACCGCCCTCCTTCTT | No data | ||
| Right | 1203289117 | 22_KI270735v1_random:17257-17279 | TCCCATCGCCGCCACGTGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1203289108 | Original CRISPR | AAGAAGGAGGGCGGTGGCGG GGG (reversed) | Intergenic | ||