ID: 1203289109

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270735v1_random:17232-17254
Sequence AAAGAAGGAGGGCGGTGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203289109_1203289117 2 Left 1203289109 22_KI270735v1_random:17232-17254 CCCCGCCACCGCCCTCCTTCTTT No data
Right 1203289117 22_KI270735v1_random:17257-17279 TCCCATCGCCGCCACGTGCAAGG No data
1203289109_1203289123 25 Left 1203289109 22_KI270735v1_random:17232-17254 CCCCGCCACCGCCCTCCTTCTTT No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203289109 Original CRISPR AAAGAAGGAGGGCGGTGGCG GGG (reversed) Intergenic