ID: 1203289111

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270735v1_random:17234-17256
Sequence GAAAAGAAGGAGGGCGGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203289111_1203289123 23 Left 1203289111 22_KI270735v1_random:17234-17256 CCGCCACCGCCCTCCTTCTTTTC No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289111_1203289117 0 Left 1203289111 22_KI270735v1_random:17234-17256 CCGCCACCGCCCTCCTTCTTTTC No data
Right 1203289117 22_KI270735v1_random:17257-17279 TCCCATCGCCGCCACGTGCAAGG No data
1203289111_1203289124 29 Left 1203289111 22_KI270735v1_random:17234-17256 CCGCCACCGCCCTCCTTCTTTTC No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203289111 Original CRISPR GAAAAGAAGGAGGGCGGTGG CGG (reversed) Intergenic