ID: 1203289112

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270735v1_random:17237-17259
Sequence GGAGAAAAGAAGGAGGGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203289112_1203289125 30 Left 1203289112 22_KI270735v1_random:17237-17259 CCACCGCCCTCCTTCTTTTCTCC No data
Right 1203289125 22_KI270735v1_random:17290-17312 CAAGACTCAGCGGCCCAGGCAGG No data
1203289112_1203289117 -3 Left 1203289112 22_KI270735v1_random:17237-17259 CCACCGCCCTCCTTCTTTTCTCC No data
Right 1203289117 22_KI270735v1_random:17257-17279 TCCCATCGCCGCCACGTGCAAGG No data
1203289112_1203289124 26 Left 1203289112 22_KI270735v1_random:17237-17259 CCACCGCCCTCCTTCTTTTCTCC No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data
1203289112_1203289123 20 Left 1203289112 22_KI270735v1_random:17237-17259 CCACCGCCCTCCTTCTTTTCTCC No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203289112 Original CRISPR GGAGAAAAGAAGGAGGGCGG TGG (reversed) Intergenic