ID: 1203289114

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270735v1_random:17243-17265
Sequence GCGATGGGAGAAAAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203289114_1203289125 24 Left 1203289114 22_KI270735v1_random:17243-17265 CCCTCCTTCTTTTCTCCCATCGC No data
Right 1203289125 22_KI270735v1_random:17290-17312 CAAGACTCAGCGGCCCAGGCAGG No data
1203289114_1203289123 14 Left 1203289114 22_KI270735v1_random:17243-17265 CCCTCCTTCTTTTCTCCCATCGC No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289114_1203289117 -9 Left 1203289114 22_KI270735v1_random:17243-17265 CCCTCCTTCTTTTCTCCCATCGC No data
Right 1203289117 22_KI270735v1_random:17257-17279 TCCCATCGCCGCCACGTGCAAGG No data
1203289114_1203289126 25 Left 1203289114 22_KI270735v1_random:17243-17265 CCCTCCTTCTTTTCTCCCATCGC No data
Right 1203289126 22_KI270735v1_random:17291-17313 AAGACTCAGCGGCCCAGGCAGGG No data
1203289114_1203289124 20 Left 1203289114 22_KI270735v1_random:17243-17265 CCCTCCTTCTTTTCTCCCATCGC No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data
1203289114_1203289128 27 Left 1203289114 22_KI270735v1_random:17243-17265 CCCTCCTTCTTTTCTCCCATCGC No data
Right 1203289128 22_KI270735v1_random:17293-17315 GACTCAGCGGCCCAGGCAGGGGG No data
1203289114_1203289127 26 Left 1203289114 22_KI270735v1_random:17243-17265 CCCTCCTTCTTTTCTCCCATCGC No data
Right 1203289127 22_KI270735v1_random:17292-17314 AGACTCAGCGGCCCAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203289114 Original CRISPR GCGATGGGAGAAAAGAAGGA GGG (reversed) Intergenic