ID: 1203289115

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270735v1_random:17244-17266
Sequence GGCGATGGGAGAAAAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203289115_1203289126 24 Left 1203289115 22_KI270735v1_random:17244-17266 CCTCCTTCTTTTCTCCCATCGCC No data
Right 1203289126 22_KI270735v1_random:17291-17313 AAGACTCAGCGGCCCAGGCAGGG No data
1203289115_1203289117 -10 Left 1203289115 22_KI270735v1_random:17244-17266 CCTCCTTCTTTTCTCCCATCGCC No data
Right 1203289117 22_KI270735v1_random:17257-17279 TCCCATCGCCGCCACGTGCAAGG No data
1203289115_1203289127 25 Left 1203289115 22_KI270735v1_random:17244-17266 CCTCCTTCTTTTCTCCCATCGCC No data
Right 1203289127 22_KI270735v1_random:17292-17314 AGACTCAGCGGCCCAGGCAGGGG No data
1203289115_1203289128 26 Left 1203289115 22_KI270735v1_random:17244-17266 CCTCCTTCTTTTCTCCCATCGCC No data
Right 1203289128 22_KI270735v1_random:17293-17315 GACTCAGCGGCCCAGGCAGGGGG No data
1203289115_1203289124 19 Left 1203289115 22_KI270735v1_random:17244-17266 CCTCCTTCTTTTCTCCCATCGCC No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data
1203289115_1203289125 23 Left 1203289115 22_KI270735v1_random:17244-17266 CCTCCTTCTTTTCTCCCATCGCC No data
Right 1203289125 22_KI270735v1_random:17290-17312 CAAGACTCAGCGGCCCAGGCAGG No data
1203289115_1203289123 13 Left 1203289115 22_KI270735v1_random:17244-17266 CCTCCTTCTTTTCTCCCATCGCC No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203289115 Original CRISPR GGCGATGGGAGAAAAGAAGG AGG (reversed) Intergenic