ID: 1203289116

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270735v1_random:17247-17269
Sequence GGCGGCGATGGGAGAAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203289116_1203289126 21 Left 1203289116 22_KI270735v1_random:17247-17269 CCTTCTTTTCTCCCATCGCCGCC No data
Right 1203289126 22_KI270735v1_random:17291-17313 AAGACTCAGCGGCCCAGGCAGGG No data
1203289116_1203289127 22 Left 1203289116 22_KI270735v1_random:17247-17269 CCTTCTTTTCTCCCATCGCCGCC No data
Right 1203289127 22_KI270735v1_random:17292-17314 AGACTCAGCGGCCCAGGCAGGGG No data
1203289116_1203289125 20 Left 1203289116 22_KI270735v1_random:17247-17269 CCTTCTTTTCTCCCATCGCCGCC No data
Right 1203289125 22_KI270735v1_random:17290-17312 CAAGACTCAGCGGCCCAGGCAGG No data
1203289116_1203289128 23 Left 1203289116 22_KI270735v1_random:17247-17269 CCTTCTTTTCTCCCATCGCCGCC No data
Right 1203289128 22_KI270735v1_random:17293-17315 GACTCAGCGGCCCAGGCAGGGGG No data
1203289116_1203289124 16 Left 1203289116 22_KI270735v1_random:17247-17269 CCTTCTTTTCTCCCATCGCCGCC No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data
1203289116_1203289123 10 Left 1203289116 22_KI270735v1_random:17247-17269 CCTTCTTTTCTCCCATCGCCGCC No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289116_1203289129 28 Left 1203289116 22_KI270735v1_random:17247-17269 CCTTCTTTTCTCCCATCGCCGCC No data
Right 1203289129 22_KI270735v1_random:17298-17320 AGCGGCCCAGGCAGGGGGCTCGG No data
1203289116_1203289130 29 Left 1203289116 22_KI270735v1_random:17247-17269 CCTTCTTTTCTCCCATCGCCGCC No data
Right 1203289130 22_KI270735v1_random:17299-17321 GCGGCCCAGGCAGGGGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203289116 Original CRISPR GGCGGCGATGGGAGAAAAGA AGG (reversed) Intergenic