ID: 1203289119

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270735v1_random:17259-17281
Sequence GGCCTTGCACGTGGCGGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203289119_1203289127 10 Left 1203289119 22_KI270735v1_random:17259-17281 CCATCGCCGCCACGTGCAAGGCC No data
Right 1203289127 22_KI270735v1_random:17292-17314 AGACTCAGCGGCCCAGGCAGGGG No data
1203289119_1203289128 11 Left 1203289119 22_KI270735v1_random:17259-17281 CCATCGCCGCCACGTGCAAGGCC No data
Right 1203289128 22_KI270735v1_random:17293-17315 GACTCAGCGGCCCAGGCAGGGGG No data
1203289119_1203289134 30 Left 1203289119 22_KI270735v1_random:17259-17281 CCATCGCCGCCACGTGCAAGGCC No data
Right 1203289134 22_KI270735v1_random:17312-17334 GGGGCTCGGGCACCTAGGCAAGG No data
1203289119_1203289129 16 Left 1203289119 22_KI270735v1_random:17259-17281 CCATCGCCGCCACGTGCAAGGCC No data
Right 1203289129 22_KI270735v1_random:17298-17320 AGCGGCCCAGGCAGGGGGCTCGG No data
1203289119_1203289126 9 Left 1203289119 22_KI270735v1_random:17259-17281 CCATCGCCGCCACGTGCAAGGCC No data
Right 1203289126 22_KI270735v1_random:17291-17313 AAGACTCAGCGGCCCAGGCAGGG No data
1203289119_1203289124 4 Left 1203289119 22_KI270735v1_random:17259-17281 CCATCGCCGCCACGTGCAAGGCC No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data
1203289119_1203289125 8 Left 1203289119 22_KI270735v1_random:17259-17281 CCATCGCCGCCACGTGCAAGGCC No data
Right 1203289125 22_KI270735v1_random:17290-17312 CAAGACTCAGCGGCCCAGGCAGG No data
1203289119_1203289130 17 Left 1203289119 22_KI270735v1_random:17259-17281 CCATCGCCGCCACGTGCAAGGCC No data
Right 1203289130 22_KI270735v1_random:17299-17321 GCGGCCCAGGCAGGGGGCTCGGG No data
1203289119_1203289123 -2 Left 1203289119 22_KI270735v1_random:17259-17281 CCATCGCCGCCACGTGCAAGGCC No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289119_1203289133 25 Left 1203289119 22_KI270735v1_random:17259-17281 CCATCGCCGCCACGTGCAAGGCC No data
Right 1203289133 22_KI270735v1_random:17307-17329 GGCAGGGGGCTCGGGCACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203289119 Original CRISPR GGCCTTGCACGTGGCGGCGA TGG (reversed) Intergenic