ID: 1203289123

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270735v1_random:17280-17302
Sequence CCGCTCTATGCAAGACTCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203289115_1203289123 13 Left 1203289115 22_KI270735v1_random:17244-17266 CCTCCTTCTTTTCTCCCATCGCC No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289118_1203289123 -1 Left 1203289118 22_KI270735v1_random:17258-17280 CCCATCGCCGCCACGTGCAAGGC No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289112_1203289123 20 Left 1203289112 22_KI270735v1_random:17237-17259 CCACCGCCCTCCTTCTTTTCTCC No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289120_1203289123 -8 Left 1203289120 22_KI270735v1_random:17265-17287 CCGCCACGTGCAAGGCCGCTCTA No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289114_1203289123 14 Left 1203289114 22_KI270735v1_random:17243-17265 CCCTCCTTCTTTTCTCCCATCGC No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289110_1203289123 24 Left 1203289110 22_KI270735v1_random:17233-17255 CCCGCCACCGCCCTCCTTCTTTT No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289113_1203289123 17 Left 1203289113 22_KI270735v1_random:17240-17262 CCGCCCTCCTTCTTTTCTCCCAT No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289119_1203289123 -2 Left 1203289119 22_KI270735v1_random:17259-17281 CCATCGCCGCCACGTGCAAGGCC No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289116_1203289123 10 Left 1203289116 22_KI270735v1_random:17247-17269 CCTTCTTTTCTCCCATCGCCGCC No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289111_1203289123 23 Left 1203289111 22_KI270735v1_random:17234-17256 CCGCCACCGCCCTCCTTCTTTTC No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289108_1203289123 26 Left 1203289108 22_KI270735v1_random:17231-17253 CCCCCGCCACCGCCCTCCTTCTT No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data
1203289109_1203289123 25 Left 1203289109 22_KI270735v1_random:17232-17254 CCCCGCCACCGCCCTCCTTCTTT No data
Right 1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203289123 Original CRISPR CCGCTCTATGCAAGACTCAG CGG Intergenic
No off target data available for this crispr