ID: 1203289124

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270735v1_random:17286-17308
Sequence TATGCAAGACTCAGCGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203289112_1203289124 26 Left 1203289112 22_KI270735v1_random:17237-17259 CCACCGCCCTCCTTCTTTTCTCC No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data
1203289110_1203289124 30 Left 1203289110 22_KI270735v1_random:17233-17255 CCCGCCACCGCCCTCCTTCTTTT No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data
1203289120_1203289124 -2 Left 1203289120 22_KI270735v1_random:17265-17287 CCGCCACGTGCAAGGCCGCTCTA No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data
1203289111_1203289124 29 Left 1203289111 22_KI270735v1_random:17234-17256 CCGCCACCGCCCTCCTTCTTTTC No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data
1203289118_1203289124 5 Left 1203289118 22_KI270735v1_random:17258-17280 CCCATCGCCGCCACGTGCAAGGC No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data
1203289119_1203289124 4 Left 1203289119 22_KI270735v1_random:17259-17281 CCATCGCCGCCACGTGCAAGGCC No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data
1203289121_1203289124 -5 Left 1203289121 22_KI270735v1_random:17268-17290 CCACGTGCAAGGCCGCTCTATGC No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data
1203289114_1203289124 20 Left 1203289114 22_KI270735v1_random:17243-17265 CCCTCCTTCTTTTCTCCCATCGC No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data
1203289113_1203289124 23 Left 1203289113 22_KI270735v1_random:17240-17262 CCGCCCTCCTTCTTTTCTCCCAT No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data
1203289115_1203289124 19 Left 1203289115 22_KI270735v1_random:17244-17266 CCTCCTTCTTTTCTCCCATCGCC No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data
1203289116_1203289124 16 Left 1203289116 22_KI270735v1_random:17247-17269 CCTTCTTTTCTCCCATCGCCGCC No data
Right 1203289124 22_KI270735v1_random:17286-17308 TATGCAAGACTCAGCGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203289124 Original CRISPR TATGCAAGACTCAGCGGCCC AGG Intergenic