ID: 1203292563

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270736v1_random:9576-9598
Sequence CTGGGTCCACAAATCTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203292563_1203292565 -6 Left 1203292563 22_KI270736v1_random:9576-9598 CCATGTTAGATTTGTGGACCCAG No data
Right 1203292565 22_KI270736v1_random:9593-9615 ACCCAGCATGGTTTTTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203292563 Original CRISPR CTGGGTCCACAAATCTAACA TGG (reversed) Intergenic
No off target data available for this crispr