ID: 1203293066

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270736v1_random:14038-14060
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203293066_1203293069 15 Left 1203293066 22_KI270736v1_random:14038-14060 CCTCCAAATGCTGTCTTATCCAG No data
Right 1203293069 22_KI270736v1_random:14076-14098 CATGTGCTATCCCAACCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203293066 Original CRISPR CTGGATAAGACAGCATTTGG AGG (reversed) Intergenic
No off target data available for this crispr