ID: 1203294596

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270736v1_random:29824-29846
Sequence CAGGAAAAAGTTTAGCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203294596_1203294598 -7 Left 1203294596 22_KI270736v1_random:29824-29846 CCATGGGGCTAAACTTTTTCCTG No data
Right 1203294598 22_KI270736v1_random:29840-29862 TTTCCTGTCCTATGGATTTATGG No data
1203294596_1203294602 9 Left 1203294596 22_KI270736v1_random:29824-29846 CCATGGGGCTAAACTTTTTCCTG No data
Right 1203294602 22_KI270736v1_random:29856-29878 TTTATGGCCTCACATGTGGATGG No data
1203294596_1203294603 10 Left 1203294596 22_KI270736v1_random:29824-29846 CCATGGGGCTAAACTTTTTCCTG No data
Right 1203294603 22_KI270736v1_random:29857-29879 TTATGGCCTCACATGTGGATGGG No data
1203294596_1203294601 5 Left 1203294596 22_KI270736v1_random:29824-29846 CCATGGGGCTAAACTTTTTCCTG No data
Right 1203294601 22_KI270736v1_random:29852-29874 TGGATTTATGGCCTCACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203294596 Original CRISPR CAGGAAAAAGTTTAGCCCCA TGG (reversed) Intergenic