ID: 1203295590

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270736v1_random:40301-40323
Sequence ATGCCTGTCTATATGCAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203295586_1203295590 24 Left 1203295586 22_KI270736v1_random:40254-40276 CCTCGAGTTTATTGTATTGTGTG No data
Right 1203295590 22_KI270736v1_random:40301-40323 ATGCCTGTCTATATGCAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203295590 Original CRISPR ATGCCTGTCTATATGCAGGA CGG Intergenic
No off target data available for this crispr