ID: 1203296358

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270736v1_random:46411-46433
Sequence AGGAGCAAAGTGGGTACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203296354_1203296358 -7 Left 1203296354 22_KI270736v1_random:46395-46417 CCAGAGACCAGGTGTGAGGAGCA No data
Right 1203296358 22_KI270736v1_random:46411-46433 AGGAGCAAAGTGGGTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203296358 Original CRISPR AGGAGCAAAGTGGGTACAGA TGG Intergenic
No off target data available for this crispr