ID: 1203333715

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270739v1_random:36251-36273
Sequence GTGCCGTATTTTAAGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203333715_1203333720 11 Left 1203333715 22_KI270739v1_random:36251-36273 CCCACCAGCTTAAAATACGGCAC No data
Right 1203333720 22_KI270739v1_random:36285-36307 ATATCCCGCACCTGACTCGGAGG No data
1203333715_1203333719 8 Left 1203333715 22_KI270739v1_random:36251-36273 CCCACCAGCTTAAAATACGGCAC No data
Right 1203333719 22_KI270739v1_random:36282-36304 ATTATATCCCGCACCTGACTCGG 0: 11
1: 662
2: 1290
3: 1147
4: 600
1203333715_1203333721 12 Left 1203333715 22_KI270739v1_random:36251-36273 CCCACCAGCTTAAAATACGGCAC No data
Right 1203333721 22_KI270739v1_random:36286-36308 TATCCCGCACCTGACTCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203333715 Original CRISPR GTGCCGTATTTTAAGCTGGT GGG (reversed) Intergenic
No off target data available for this crispr