ID: 1203343633

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270442v1:15941-15963
Sequence TCCTTTCTATTCCATTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203343633_1203343637 26 Left 1203343633 Un_KI270442v1:15941-15963 CCAATGGAATGGAATAGAAAGGA No data
Right 1203343637 Un_KI270442v1:15990-16012 TTGAATGGAATTGAATCGAATGG No data
1203343633_1203343636 11 Left 1203343633 Un_KI270442v1:15941-15963 CCAATGGAATGGAATAGAAAGGA No data
Right 1203343636 Un_KI270442v1:15975-15997 TTGATTGGAAAAGAATTGAATGG No data
1203343633_1203343635 -4 Left 1203343633 Un_KI270442v1:15941-15963 CCAATGGAATGGAATAGAAAGGA No data
Right 1203343635 Un_KI270442v1:15960-15982 AGGAATGGAATGCAATTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203343633 Original CRISPR TCCTTTCTATTCCATTCCAT TGG (reversed) Intergenic
No off target data available for this crispr