ID: 1203343637

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270442v1:15990-16012
Sequence TTGAATGGAATTGAATCGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203343633_1203343637 26 Left 1203343633 Un_KI270442v1:15941-15963 CCAATGGAATGGAATAGAAAGGA No data
Right 1203343637 Un_KI270442v1:15990-16012 TTGAATGGAATTGAATCGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203343637 Original CRISPR TTGAATGGAATTGAATCGAA TGG Intergenic
No off target data available for this crispr