ID: 1203361015

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270442v1:219180-219202
Sequence TTTCTTGGAAGCTGCCCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203361013_1203361015 -10 Left 1203361013 Un_KI270442v1:219167-219189 CCAAAGACTTTAGTTTCTTGGAA No data
Right 1203361015 Un_KI270442v1:219180-219202 TTTCTTGGAAGCTGCCCAGCGGG No data
1203361007_1203361015 7 Left 1203361007 Un_KI270442v1:219150-219172 CCCCGGAACCTAAAAACCCAAAG No data
Right 1203361015 Un_KI270442v1:219180-219202 TTTCTTGGAAGCTGCCCAGCGGG No data
1203361009_1203361015 5 Left 1203361009 Un_KI270442v1:219152-219174 CCGGAACCTAAAAACCCAAAGAC No data
Right 1203361015 Un_KI270442v1:219180-219202 TTTCTTGGAAGCTGCCCAGCGGG No data
1203361010_1203361015 -1 Left 1203361010 Un_KI270442v1:219158-219180 CCTAAAAACCCAAAGACTTTAGT No data
Right 1203361015 Un_KI270442v1:219180-219202 TTTCTTGGAAGCTGCCCAGCGGG No data
1203361004_1203361015 16 Left 1203361004 Un_KI270442v1:219141-219163 CCATACTCCCCCCGGAACCTAAA No data
Right 1203361015 Un_KI270442v1:219180-219202 TTTCTTGGAAGCTGCCCAGCGGG No data
1203361008_1203361015 6 Left 1203361008 Un_KI270442v1:219151-219173 CCCGGAACCTAAAAACCCAAAGA No data
Right 1203361015 Un_KI270442v1:219180-219202 TTTCTTGGAAGCTGCCCAGCGGG No data
1203361006_1203361015 8 Left 1203361006 Un_KI270442v1:219149-219171 CCCCCGGAACCTAAAAACCCAAA No data
Right 1203361015 Un_KI270442v1:219180-219202 TTTCTTGGAAGCTGCCCAGCGGG No data
1203361005_1203361015 9 Left 1203361005 Un_KI270442v1:219148-219170 CCCCCCGGAACCTAAAAACCCAA No data
Right 1203361015 Un_KI270442v1:219180-219202 TTTCTTGGAAGCTGCCCAGCGGG No data
1203361012_1203361015 -9 Left 1203361012 Un_KI270442v1:219166-219188 CCCAAAGACTTTAGTTTCTTGGA No data
Right 1203361015 Un_KI270442v1:219180-219202 TTTCTTGGAAGCTGCCCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203361015 Original CRISPR TTTCTTGGAAGCTGCCCAGC GGG Intergenic
No off target data available for this crispr