ID: 1203362403

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270442v1:228506-228528
Sequence GATACCTCTGCATTGGCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203362403_1203362407 -6 Left 1203362403 Un_KI270442v1:228506-228528 CCTCGGGCCAATGCAGAGGTATC No data
Right 1203362407 Un_KI270442v1:228523-228545 GGTATCCATTTGACCTCGGTGGG No data
1203362403_1203362411 11 Left 1203362403 Un_KI270442v1:228506-228528 CCTCGGGCCAATGCAGAGGTATC No data
Right 1203362411 Un_KI270442v1:228540-228562 GGTGGGACAGGTCAGCTTTGCGG No data
1203362403_1203362406 -7 Left 1203362403 Un_KI270442v1:228506-228528 CCTCGGGCCAATGCAGAGGTATC No data
Right 1203362406 Un_KI270442v1:228522-228544 AGGTATCCATTTGACCTCGGTGG No data
1203362403_1203362405 -10 Left 1203362403 Un_KI270442v1:228506-228528 CCTCGGGCCAATGCAGAGGTATC No data
Right 1203362405 Un_KI270442v1:228519-228541 CAGAGGTATCCATTTGACCTCGG No data
1203362403_1203362409 -1 Left 1203362403 Un_KI270442v1:228506-228528 CCTCGGGCCAATGCAGAGGTATC No data
Right 1203362409 Un_KI270442v1:228528-228550 CCATTTGACCTCGGTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203362403 Original CRISPR GATACCTCTGCATTGGCCCG AGG (reversed) Intergenic
No off target data available for this crispr