ID: 1203362663

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270442v1:231162-231184
Sequence ACGTGGGTAGTGGGGGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203362653_1203362663 8 Left 1203362653 Un_KI270442v1:231131-231153 CCTAACTGTCTCACTAAATGAAG No data
Right 1203362663 Un_KI270442v1:231162-231184 ACGTGGGTAGTGGGGGGAGCCGG No data
1203362651_1203362663 12 Left 1203362651 Un_KI270442v1:231127-231149 CCCACCTAACTGTCTCACTAAAT No data
Right 1203362663 Un_KI270442v1:231162-231184 ACGTGGGTAGTGGGGGGAGCCGG No data
1203362652_1203362663 11 Left 1203362652 Un_KI270442v1:231128-231150 CCACCTAACTGTCTCACTAAATG No data
Right 1203362663 Un_KI270442v1:231162-231184 ACGTGGGTAGTGGGGGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203362663 Original CRISPR ACGTGGGTAGTGGGGGGAGC CGG Intergenic
No off target data available for this crispr