ID: 1203363764

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270442v1:239682-239704
Sequence GGTTCCAGACAACCACAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203363760_1203363764 9 Left 1203363760 Un_KI270442v1:239650-239672 CCTACAAGCATACTCAGAGATAG No data
Right 1203363764 Un_KI270442v1:239682-239704 GGTTCCAGACAACCACAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203363764 Original CRISPR GGTTCCAGACAACCACAAGA AGG Intergenic
No off target data available for this crispr